FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623914_at:

>probe:Drosophila_2:1623914_at:434:579; Interrogation_Position=120; Antisense; GGCCATTGTCGACGTCATTGACCAA
>probe:Drosophila_2:1623914_at:188:91; Interrogation_Position=150; Antisense; AGTTCTGGTAGATGGTCCTCTGACT
>probe:Drosophila_2:1623914_at:524:329; Interrogation_Position=176; Antisense; GCGTGCCCCGTCAGGAATACAGATT
>probe:Drosophila_2:1623914_at:350:159; Interrogation_Position=203; Antisense; ACAATCTGCATCTGACCAAGTACCG
>probe:Drosophila_2:1623914_at:479:347; Interrogation_Position=257; Antisense; GCATCGTGCGCAAGGCCTGGACAGA
>probe:Drosophila_2:1623914_at:114:535; Interrogation_Position=317; Antisense; GGTCCGTCAAGGCACAGAACATCTG
>probe:Drosophila_2:1623914_at:639:205; Interrogation_Position=343; Antisense; AAGCGCTCCTCGTTGAACGACTTTG
>probe:Drosophila_2:1623914_at:699:381; Interrogation_Position=357; Antisense; GAACGACTTTGACCGCTTCAAGCTG
>probe:Drosophila_2:1623914_at:461:651; Interrogation_Position=374; Antisense; TCAAGCTGCGTTATGCCAAGCGTCA
>probe:Drosophila_2:1623914_at:37:497; Interrogation_Position=43; Antisense; GTCATGCCTTTCGAGAGATTCGTAC
>probe:Drosophila_2:1623914_at:361:211; Interrogation_Position=436; Antisense; AAGAAGCGCACCAAGGCTGACGGCA
>probe:Drosophila_2:1623914_at:324:253; Interrogation_Position=474; Antisense; CAAGAAGGATCGTCGCGAGCGTCTG
>probe:Drosophila_2:1623914_at:682:427; Interrogation_Position=57; Antisense; GAGATTCGTACAAACTGGTCGCATT
>probe:Drosophila_2:1623914_at:358:607; Interrogation_Position=577; Antisense; TGATGAACATCCACCACCATGGAGA

Paste this into a BLAST search page for me
GGCCATTGTCGACGTCATTGACCAAAGTTCTGGTAGATGGTCCTCTGACTGCGTGCCCCGTCAGGAATACAGATTACAATCTGCATCTGACCAAGTACCGGCATCGTGCGCAAGGCCTGGACAGAGGTCCGTCAAGGCACAGAACATCTGAAGCGCTCCTCGTTGAACGACTTTGGAACGACTTTGACCGCTTCAAGCTGTCAAGCTGCGTTATGCCAAGCGTCAGTCATGCCTTTCGAGAGATTCGTACAAGAAGCGCACCAAGGCTGACGGCACAAGAAGGATCGTCGCGAGCGTCTGGAGATTCGTACAAACTGGTCGCATTTGATGAACATCCACCACCATGGAGA

Full Affymetrix probeset data:

Annotations for 1623914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720