FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623915_at:

>probe:Drosophila_2:1623915_at:666:507; Interrogation_Position=394; Antisense; GTGCTCATGATCAGCGTGGGCATTT
>probe:Drosophila_2:1623915_at:108:519; Interrogation_Position=409; Antisense; GTGGGCATTTTCGTCTGCACATATT
>probe:Drosophila_2:1623915_at:276:19; Interrogation_Position=429; Antisense; ATATTTCTCCAGTCCGGATTTGGTG
>probe:Drosophila_2:1623915_at:428:635; Interrogation_Position=534; Antisense; TCTATTTGTTTCCTCCTACATGGGA
>probe:Drosophila_2:1623915_at:90:269; Interrogation_Position=565; Antisense; CAGGAGTTGCTGTATCGACGTCATG
>probe:Drosophila_2:1623915_at:31:563; Interrogation_Position=603; Antisense; GGAAGCGTTGTATTACACCCACCTG
>probe:Drosophila_2:1623915_at:52:719; Interrogation_Position=643; Antisense; TTCCTGCTCATGCATGACGACATAC
>probe:Drosophila_2:1623915_at:317:303; Interrogation_Position=733; Antisense; CCCCTAATCCTGCTATACTTATTGG
>probe:Drosophila_2:1623915_at:267:703; Interrogation_Position=751; Antisense; TTATTGGGCAACGTGCTTGCGCAGC
>probe:Drosophila_2:1623915_at:521:115; Interrogation_Position=773; Antisense; AGCATTTGTGCATCAGCTCCGTTTA
>probe:Drosophila_2:1623915_at:470:351; Interrogation_Position=815; Antisense; GCAGCTCGCTGACGGTGACTCTGAT
>probe:Drosophila_2:1623915_at:608:215; Interrogation_Position=853; Antisense; AAGTTCATCTCGCTGGTCTTTTCGA
>probe:Drosophila_2:1623915_at:608:533; Interrogation_Position=867; Antisense; GGTCTTTTCGATCGTATACTTCCGA
>probe:Drosophila_2:1623915_at:706:277; Interrogation_Position=933; Antisense; CTTTGTGGGCACCTTGATGTTTGCA

Paste this into a BLAST search page for me
GTGCTCATGATCAGCGTGGGCATTTGTGGGCATTTTCGTCTGCACATATTATATTTCTCCAGTCCGGATTTGGTGTCTATTTGTTTCCTCCTACATGGGACAGGAGTTGCTGTATCGACGTCATGGGAAGCGTTGTATTACACCCACCTGTTCCTGCTCATGCATGACGACATACCCCCTAATCCTGCTATACTTATTGGTTATTGGGCAACGTGCTTGCGCAGCAGCATTTGTGCATCAGCTCCGTTTAGCAGCTCGCTGACGGTGACTCTGATAAGTTCATCTCGCTGGTCTTTTCGAGGTCTTTTCGATCGTATACTTCCGACTTTGTGGGCACCTTGATGTTTGCA

Full Affymetrix probeset data:

Annotations for 1623915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720