Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623916_at:

>probe:Drosophila_2:1623916_at:21:343; Interrogation_Position=1002; Antisense; GCTTTCCTGCTGGACCGATGATATA
>probe:Drosophila_2:1623916_at:141:23; Interrogation_Position=1026; Antisense; ATATCTGTCCTATCTTGGCTATGTG
>probe:Drosophila_2:1623916_at:130:63; Interrogation_Position=1046; Antisense; ATGTGCTGTATGGAGGCCTGTTTGC
>probe:Drosophila_2:1623916_at:54:603; Interrogation_Position=1064; Antisense; TGTTTGCCTTCACCATAACAGTGGC
>probe:Drosophila_2:1623916_at:311:341; Interrogation_Position=1124; Antisense; GCTTCGCTCTGGTGTTTGGTTTCAA
>probe:Drosophila_2:1623916_at:65:87; Interrogation_Position=1172; Antisense; AGTGCATCCTCACATTTGTCGTCGT
>probe:Drosophila_2:1623916_at:657:641; Interrogation_Position=1186; Antisense; TTTGTCGTCGTCTCGGAAAAGGCCA
>probe:Drosophila_2:1623916_at:277:701; Interrogation_Position=1227; Antisense; TTTTCAACAGTTTTCCGTCTACGCA
>probe:Drosophila_2:1623916_at:716:549; Interrogation_Position=758; Antisense; GGAGCTTGTGGTATGCCATCAGTTT
>probe:Drosophila_2:1623916_at:41:273; Interrogation_Position=774; Antisense; CATCAGTTTGGCTGGATTTCTGCAA
>probe:Drosophila_2:1623916_at:207:19; Interrogation_Position=789; Antisense; ATTTCTGCAAATCACCACCTATATG
>probe:Drosophila_2:1623916_at:147:541; Interrogation_Position=916; Antisense; GGTTATTTCCATGCTGGACGTCTGA
>probe:Drosophila_2:1623916_at:303:441; Interrogation_Position=963; Antisense; GATGGCTCTGCTGTCGGTCCTGGAA
>probe:Drosophila_2:1623916_at:216:71; Interrogation_Position=987; Antisense; AGGAGGTTGTGTTTTGCTTTCCTGC

Paste this into a BLAST search page for me
GCTTTCCTGCTGGACCGATGATATAATATCTGTCCTATCTTGGCTATGTGATGTGCTGTATGGAGGCCTGTTTGCTGTTTGCCTTCACCATAACAGTGGCGCTTCGCTCTGGTGTTTGGTTTCAAAGTGCATCCTCACATTTGTCGTCGTTTTGTCGTCGTCTCGGAAAAGGCCATTTTCAACAGTTTTCCGTCTACGCAGGAGCTTGTGGTATGCCATCAGTTTCATCAGTTTGGCTGGATTTCTGCAAATTTCTGCAAATCACCACCTATATGGGTTATTTCCATGCTGGACGTCTGAGATGGCTCTGCTGTCGGTCCTGGAAAGGAGGTTGTGTTTTGCTTTCCTGC

Full Affymetrix probeset data:

Annotations for 1623916_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime