FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623918_at:

>probe:Drosophila_2:1623918_at:604:439; Interrogation_Position=1032; Antisense; GATGGATGTTCCTGGTACCACTGGC
>probe:Drosophila_2:1623918_at:70:341; Interrogation_Position=1055; Antisense; GCTACCGATCCGTCGATCTATGATA
>probe:Drosophila_2:1623918_at:541:453; Interrogation_Position=1076; Antisense; GATAACACCCTTTACTGGAATGCAT
>probe:Drosophila_2:1623918_at:519:19; Interrogation_Position=1111; Antisense; ATTTGTATGTATCAACCGCTGCCAT
>probe:Drosophila_2:1623918_at:671:313; Interrogation_Position=1131; Antisense; GCCATACGTCGGTTCATTCATGTGT
>probe:Drosophila_2:1623918_at:667:663; Interrogation_Position=1190; Antisense; TAAATTGCATATCCCATTCGAGCCA
>probe:Drosophila_2:1623918_at:482:71; Interrogation_Position=802; Antisense; AGGCGTGGAGTTGAGCACTGCCCTA
>probe:Drosophila_2:1623918_at:643:283; Interrogation_Position=819; Antisense; CTGCCCTATTGATTGGACTGTTCCA
>probe:Drosophila_2:1623918_at:106:667; Interrogation_Position=851; Antisense; TACACCACGCTATTTGGCTTCTATT
>probe:Drosophila_2:1623918_at:207:689; Interrogation_Position=872; Antisense; TATTCGGCCTTTCTATTTGCCCGTA
>probe:Drosophila_2:1623918_at:243:489; Interrogation_Position=894; Antisense; GTACAGGTCATGTGATGGCTCCCAT
>probe:Drosophila_2:1623918_at:287:271; Interrogation_Position=916; Antisense; CATCTTGGTGCACGCGTTTTGCAAT
>probe:Drosophila_2:1623918_at:133:239; Interrogation_Position=938; Antisense; AATCATATGGGTCTGCCGGATCTGC
>probe:Drosophila_2:1623918_at:617:517; Interrogation_Position=998; Antisense; GTGGCCATTATTCTCTACTTAGCTG

Paste this into a BLAST search page for me
GATGGATGTTCCTGGTACCACTGGCGCTACCGATCCGTCGATCTATGATAGATAACACCCTTTACTGGAATGCATATTTGTATGTATCAACCGCTGCCATGCCATACGTCGGTTCATTCATGTGTTAAATTGCATATCCCATTCGAGCCAAGGCGTGGAGTTGAGCACTGCCCTACTGCCCTATTGATTGGACTGTTCCATACACCACGCTATTTGGCTTCTATTTATTCGGCCTTTCTATTTGCCCGTAGTACAGGTCATGTGATGGCTCCCATCATCTTGGTGCACGCGTTTTGCAATAATCATATGGGTCTGCCGGATCTGCGTGGCCATTATTCTCTACTTAGCTG

Full Affymetrix probeset data:

Annotations for 1623918_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720