Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623920_at:

>probe:Drosophila_2:1623920_at:233:247; Interrogation_Position=1235; Antisense; AATTGGGTGCGTTGGCTAGGTCCCA
>probe:Drosophila_2:1623920_at:533:149; Interrogation_Position=1265; Antisense; ACATCATCATTCGTCCAAGGCACGT
>probe:Drosophila_2:1623920_at:471:175; Interrogation_Position=1309; Antisense; CTAACCCTGGGACACAAGCACGAGT
>probe:Drosophila_2:1623920_at:347:585; Interrogation_Position=1355; Antisense; TGGAAGTTTCCGACACCCAGATGTA
>probe:Drosophila_2:1623920_at:202:729; Interrogation_Position=1417; Antisense; TTGGAGAAGTATCACATCGCCCGTT
>probe:Drosophila_2:1623920_at:531:479; Interrogation_Position=1439; Antisense; GTTTCCAGGTGAACAGCCGTGTGCA
>probe:Drosophila_2:1623920_at:324:607; Interrogation_Position=1493; Antisense; TGATGAACAGCTGCCTGGTGCCGTT
>probe:Drosophila_2:1623920_at:463:667; Interrogation_Position=1552; Antisense; TACTTGGGTTTCCTGGACTCACTGA
>probe:Drosophila_2:1623920_at:298:651; Interrogation_Position=1570; Antisense; TCACTGATCCGGAGTTCGCATGAGT
>probe:Drosophila_2:1623920_at:705:669; Interrogation_Position=1609; Antisense; TACTGGGATCGCATCATGAACTCCG
>probe:Drosophila_2:1623920_at:76:383; Interrogation_Position=1626; Antisense; GAACTCCGCCTTTATTAAGTCTGGA
>probe:Drosophila_2:1623920_at:38:521; Interrogation_Position=1679; Antisense; GTGGCAATGATGAACCGGTGGTCCT
>probe:Drosophila_2:1623920_at:187:533; Interrogation_Position=1695; Antisense; GGTGGTCCTCAAACTGCAGCATTTC
>probe:Drosophila_2:1623920_at:485:355; Interrogation_Position=1782; Antisense; GCACTTGACCCACAACTACAATTTG

Paste this into a BLAST search page for me
AATTGGGTGCGTTGGCTAGGTCCCAACATCATCATTCGTCCAAGGCACGTCTAACCCTGGGACACAAGCACGAGTTGGAAGTTTCCGACACCCAGATGTATTGGAGAAGTATCACATCGCCCGTTGTTTCCAGGTGAACAGCCGTGTGCATGATGAACAGCTGCCTGGTGCCGTTTACTTGGGTTTCCTGGACTCACTGATCACTGATCCGGAGTTCGCATGAGTTACTGGGATCGCATCATGAACTCCGGAACTCCGCCTTTATTAAGTCTGGAGTGGCAATGATGAACCGGTGGTCCTGGTGGTCCTCAAACTGCAGCATTTCGCACTTGACCCACAACTACAATTTG

Full Affymetrix probeset data:

Annotations for 1623920_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime