FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623924_at:

>probe:Drosophila_2:1623924_at:681:269; Interrogation_Position=2635; Antisense; CTATCTGCAATGGAGCTGCTGTCTG
>probe:Drosophila_2:1623924_at:459:621; Interrogation_Position=2651; Antisense; TGCTGTCTGCTGACCAAACACGGAA
>probe:Drosophila_2:1623924_at:611:99; Interrogation_Position=2680; Antisense; AGATGGAGTCTTTCAGCACACGGGC
>probe:Drosophila_2:1623924_at:398:157; Interrogation_Position=2697; Antisense; ACACGGGCTTGCTGGCACTGCACGA
>probe:Drosophila_2:1623924_at:568:355; Interrogation_Position=2711; Antisense; GCACTGCACGAGGTTCTTTCGAGGA
>probe:Drosophila_2:1623924_at:185:157; Interrogation_Position=2775; Antisense; ACACGTTGAAAGTACTCCTGGATAG
>probe:Drosophila_2:1623924_at:34:525; Interrogation_Position=2827; Antisense; GGGCAAACCCAATGCGACGGAGGAA
>probe:Drosophila_2:1623924_at:57:73; Interrogation_Position=2862; Antisense; AGGAAATGCTACTTATCAGGTCGAA
>probe:Drosophila_2:1623924_at:633:569; Interrogation_Position=2956; Antisense; GGCTTGAATCGGAGCATTGCCAACT
>probe:Drosophila_2:1623924_at:396:419; Interrogation_Position=2967; Antisense; GAGCATTGCCAACTATTTCCTTGTT
>probe:Drosophila_2:1623924_at:381:721; Interrogation_Position=2983; Antisense; TTCCTTGTTATCTAAATCGACGCAT
>probe:Drosophila_2:1623924_at:637:459; Interrogation_Position=3013; Antisense; GATTTGATAGATGTACGCGCCTTGT
>probe:Drosophila_2:1623924_at:304:487; Interrogation_Position=3025; Antisense; GTACGCGCCTTGTCTTTTATTAAGA
>probe:Drosophila_2:1623924_at:88:531; Interrogation_Position=3083; Antisense; GGGTTCACTGAACTACGATTAGCTG

Paste this into a BLAST search page for me
CTATCTGCAATGGAGCTGCTGTCTGTGCTGTCTGCTGACCAAACACGGAAAGATGGAGTCTTTCAGCACACGGGCACACGGGCTTGCTGGCACTGCACGAGCACTGCACGAGGTTCTTTCGAGGAACACGTTGAAAGTACTCCTGGATAGGGGCAAACCCAATGCGACGGAGGAAAGGAAATGCTACTTATCAGGTCGAAGGCTTGAATCGGAGCATTGCCAACTGAGCATTGCCAACTATTTCCTTGTTTTCCTTGTTATCTAAATCGACGCATGATTTGATAGATGTACGCGCCTTGTGTACGCGCCTTGTCTTTTATTAAGAGGGTTCACTGAACTACGATTAGCTG

Full Affymetrix probeset data:

Annotations for 1623924_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720