Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623925_at:

>probe:Drosophila_2:1623925_at:24:201; Interrogation_Position=415; Antisense; AACGCATATTTGGTTGCCCGATAGC
>probe:Drosophila_2:1623925_at:289:321; Interrogation_Position=430; Antisense; GCCCGATAGCTTCACAATGCGCAAT
>probe:Drosophila_2:1623925_at:521:683; Interrogation_Position=513; Antisense; TATCCATAGCTAGATTGCCCGTTCA
>probe:Drosophila_2:1623925_at:709:47; Interrogation_Position=537; Antisense; ATCCACCGCTACCAGGTCTAAAATG
>probe:Drosophila_2:1623925_at:545:343; Interrogation_Position=601; Antisense; GCTTGCCTCGTACATGCTGTATATC
>probe:Drosophila_2:1623925_at:302:605; Interrogation_Position=636; Antisense; TGATAGATTCCGAGGCATGTGCCAA
>probe:Drosophila_2:1623925_at:131:101; Interrogation_Position=668; Antisense; AGAGTTCCATCCGTTGAGCATGTGT
>probe:Drosophila_2:1623925_at:637:457; Interrogation_Position=701; Antisense; GATAGCGATGATCTTACTGCCCAAC
>probe:Drosophila_2:1623925_at:609:467; Interrogation_Position=757; Antisense; GTTGCACAATGGTACCGTCTACGGG
>probe:Drosophila_2:1623925_at:251:671; Interrogation_Position=776; Antisense; TACGGGATCGTCACTATTCTCGCTG
>probe:Drosophila_2:1623925_at:707:687; Interrogation_Position=790; Antisense; TATTCTCGCTGGATGTGGCGTCAGC
>probe:Drosophila_2:1623925_at:352:349; Interrogation_Position=884; Antisense; GCAGGTAGCATCTTACTTGTTCCGC
>probe:Drosophila_2:1623925_at:247:321; Interrogation_Position=907; Antisense; GCCCTTATTTCGATACCTTTCTATA
>probe:Drosophila_2:1623925_at:205:355; Interrogation_Position=932; Antisense; GCACTTATCTATGTGGTAACTCTTT

Paste this into a BLAST search page for me
AACGCATATTTGGTTGCCCGATAGCGCCCGATAGCTTCACAATGCGCAATTATCCATAGCTAGATTGCCCGTTCAATCCACCGCTACCAGGTCTAAAATGGCTTGCCTCGTACATGCTGTATATCTGATAGATTCCGAGGCATGTGCCAAAGAGTTCCATCCGTTGAGCATGTGTGATAGCGATGATCTTACTGCCCAACGTTGCACAATGGTACCGTCTACGGGTACGGGATCGTCACTATTCTCGCTGTATTCTCGCTGGATGTGGCGTCAGCGCAGGTAGCATCTTACTTGTTCCGCGCCCTTATTTCGATACCTTTCTATAGCACTTATCTATGTGGTAACTCTTT

Full Affymetrix probeset data:

Annotations for 1623925_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime