Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623926_at:

>probe:Drosophila_2:1623926_at:356:131; Interrogation_Position=1561; Antisense; ACCTCCTTCCAGTGTCAGATGATAT
>probe:Drosophila_2:1623926_at:368:605; Interrogation_Position=1580; Antisense; TGATATGTCGTAATTGCTCCGGTAG
>probe:Drosophila_2:1623926_at:82:337; Interrogation_Position=1595; Antisense; GCTCCGGTAGTTATCATGGTCTCAA
>probe:Drosophila_2:1623926_at:213:201; Interrogation_Position=1630; Antisense; AACCCGCCCAATCTAAATATTGCCA
>probe:Drosophila_2:1623926_at:596:163; Interrogation_Position=1644; Antisense; AAATATTGCCATCCAGTCGTTTGTG
>probe:Drosophila_2:1623926_at:522:291; Interrogation_Position=1661; Antisense; CGTTTGTGGAGTTTGCCATGCAGCA
>probe:Drosophila_2:1623926_at:127:55; Interrogation_Position=1687; Antisense; ATGACTGCCTTTCATTGCGAGCAAG
>probe:Drosophila_2:1623926_at:628:543; Interrogation_Position=1711; Antisense; GGATTTGGATTTCCTGCTGGCACAG
>probe:Drosophila_2:1623926_at:435:115; Interrogation_Position=1740; Antisense; AGCTCCAGTTTCAGCAAAACCCAAA
>probe:Drosophila_2:1623926_at:288:611; Interrogation_Position=1899; Antisense; TGACTCGGAGTCCAGCGAAGAGCCT
>probe:Drosophila_2:1623926_at:160:117; Interrogation_Position=1929; Antisense; AGCTCCTGTGTCCAAACAGAAGCGG
>probe:Drosophila_2:1623926_at:278:643; Interrogation_Position=1992; Antisense; TCTACCTCCTCAAGTGTTTCCATTT
>probe:Drosophila_2:1623926_at:363:319; Interrogation_Position=2038; Antisense; GCCCCTTTTAACTCCATGATGTATT
>probe:Drosophila_2:1623926_at:183:443; Interrogation_Position=2055; Antisense; GATGTATTCTTATAGAGCTCCGTTT

Paste this into a BLAST search page for me
ACCTCCTTCCAGTGTCAGATGATATTGATATGTCGTAATTGCTCCGGTAGGCTCCGGTAGTTATCATGGTCTCAAAACCCGCCCAATCTAAATATTGCCAAAATATTGCCATCCAGTCGTTTGTGCGTTTGTGGAGTTTGCCATGCAGCAATGACTGCCTTTCATTGCGAGCAAGGGATTTGGATTTCCTGCTGGCACAGAGCTCCAGTTTCAGCAAAACCCAAATGACTCGGAGTCCAGCGAAGAGCCTAGCTCCTGTGTCCAAACAGAAGCGGTCTACCTCCTCAAGTGTTTCCATTTGCCCCTTTTAACTCCATGATGTATTGATGTATTCTTATAGAGCTCCGTTT

Full Affymetrix probeset data:

Annotations for 1623926_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime