FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623928_at:

>probe:Drosophila_2:1623928_at:353:159; Interrogation_Position=530; Antisense; ACAATGCCTGCAGTTCAATCAAGTG
>probe:Drosophila_2:1623928_at:201:505; Interrogation_Position=552; Antisense; GTGCCCACCGAATACACCAAAGTAT
>probe:Drosophila_2:1623928_at:688:7; Interrogation_Position=575; Antisense; ATTGCCTAGGCGGTCAGTTTATCAA
>probe:Drosophila_2:1623928_at:30:415; Interrogation_Position=601; Antisense; GACCATTGCTGGTGCGAACTGCAAC
>probe:Drosophila_2:1623928_at:104:281; Interrogation_Position=653; Antisense; CTCACGTGTGCTTCGCGGATCAGAA
>probe:Drosophila_2:1623928_at:220:373; Interrogation_Position=675; Antisense; GAAGGTGCACACATCATCCGTGGAA
>probe:Drosophila_2:1623928_at:549:619; Interrogation_Position=703; Antisense; TGCTTCACATTCGTCCAGGTCAAGG
>probe:Drosophila_2:1623928_at:31:507; Interrogation_Position=729; Antisense; GTGCTGCTGTGCTGAGATCTGGATC
>probe:Drosophila_2:1623928_at:26:209; Interrogation_Position=754; Antisense; AAGAAGTGGCGTCACATTTCCGGCA
>probe:Drosophila_2:1623928_at:726:521; Interrogation_Position=785; Antisense; GTGGCCAGCACGTGCCAAATGTGTT
>probe:Drosophila_2:1623928_at:126:509; Interrogation_Position=811; Antisense; GTGCTACTAATATTGAACCTGCTTT
>probe:Drosophila_2:1623928_at:308:381; Interrogation_Position=825; Antisense; GAACCTGCTTTCTGCATTCAGTATA
>probe:Drosophila_2:1623928_at:512:11; Interrogation_Position=840; Antisense; ATTCAGTATACTCACCTGCCGAAGA
>probe:Drosophila_2:1623928_at:223:727; Interrogation_Position=924; Antisense; TTGTTGTACAGCGTGAAGTCAGTCA

Paste this into a BLAST search page for me
ACAATGCCTGCAGTTCAATCAAGTGGTGCCCACCGAATACACCAAAGTATATTGCCTAGGCGGTCAGTTTATCAAGACCATTGCTGGTGCGAACTGCAACCTCACGTGTGCTTCGCGGATCAGAAGAAGGTGCACACATCATCCGTGGAATGCTTCACATTCGTCCAGGTCAAGGGTGCTGCTGTGCTGAGATCTGGATCAAGAAGTGGCGTCACATTTCCGGCAGTGGCCAGCACGTGCCAAATGTGTTGTGCTACTAATATTGAACCTGCTTTGAACCTGCTTTCTGCATTCAGTATAATTCAGTATACTCACCTGCCGAAGATTGTTGTACAGCGTGAAGTCAGTCA

Full Affymetrix probeset data:

Annotations for 1623928_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720