FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623932_at:

>probe:Drosophila_2:1623932_at:182:373; Interrogation_Position=2285; Antisense; GAAGTGCCGAGGTGATTAATGCCAC
>probe:Drosophila_2:1623932_at:473:709; Interrogation_Position=2300; Antisense; TTAATGCCACCATATCATCGATCCT
>probe:Drosophila_2:1623932_at:282:23; Interrogation_Position=2311; Antisense; ATATCATCGATCCTGTCCACGGTCA
>probe:Drosophila_2:1623932_at:74:497; Interrogation_Position=2332; Antisense; GTCAGCAGTTCGGTGGGCGATATCA
>probe:Drosophila_2:1623932_at:341:409; Interrogation_Position=2359; Antisense; GACGAGATGACCACAGATCCTCAGA
>probe:Drosophila_2:1623932_at:213:411; Interrogation_Position=2382; Antisense; GACGCCAGATGCACTGCTCGAAAAT
>probe:Drosophila_2:1623932_at:472:559; Interrogation_Position=2438; Antisense; GGAAAGAGTCCATGCGACACATTGT
>probe:Drosophila_2:1623932_at:457:325; Interrogation_Position=2451; Antisense; GCGACACATTGTACACAGCCATATC
>probe:Drosophila_2:1623932_at:56:187; Interrogation_Position=2483; Antisense; AACAAGATTCCGTTGACTTCAATTT
>probe:Drosophila_2:1623932_at:33:709; Interrogation_Position=2608; Antisense; TTAACTTCACTCTTTCGTCTTTTCA
>probe:Drosophila_2:1623932_at:16:639; Interrogation_Position=2622; Antisense; TCGTCTTTTCATGCCCGCGAACAAT
>probe:Drosophila_2:1623932_at:321:1; Interrogation_Position=2662; Antisense; ATAGGTTTTTGGCTAGTTGGCTAGT
>probe:Drosophila_2:1623932_at:594:243; Interrogation_Position=2764; Antisense; AATTTTCTAGCGCTTTGATGTGGCT
>probe:Drosophila_2:1623932_at:407:167; Interrogation_Position=2802; Antisense; AAATGTCAGATTTTCCGAGTATATA

Paste this into a BLAST search page for me
GAAGTGCCGAGGTGATTAATGCCACTTAATGCCACCATATCATCGATCCTATATCATCGATCCTGTCCACGGTCAGTCAGCAGTTCGGTGGGCGATATCAGACGAGATGACCACAGATCCTCAGAGACGCCAGATGCACTGCTCGAAAATGGAAAGAGTCCATGCGACACATTGTGCGACACATTGTACACAGCCATATCAACAAGATTCCGTTGACTTCAATTTTTAACTTCACTCTTTCGTCTTTTCATCGTCTTTTCATGCCCGCGAACAATATAGGTTTTTGGCTAGTTGGCTAGTAATTTTCTAGCGCTTTGATGTGGCTAAATGTCAGATTTTCCGAGTATATA

Full Affymetrix probeset data:

Annotations for 1623932_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720