Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623933_at:

>probe:Drosophila_2:1623933_at:646:651; Interrogation_Position=1239; Antisense; TCAATATTAATCACCCACACACGAC
>probe:Drosophila_2:1623933_at:170:257; Interrogation_Position=1274; Antisense; CACATGCATATACAGTTGAACCGAT
>probe:Drosophila_2:1623933_at:407:231; Interrogation_Position=1309; Antisense; AATGTTGCCATCATCATTTATGAGT
>probe:Drosophila_2:1623933_at:488:273; Interrogation_Position=1323; Antisense; CATTTATGAGTTGCCTGACATGATA
>probe:Drosophila_2:1623933_at:653:131; Interrogation_Position=1402; Antisense; ACCCACAAACACAACTTTCAGTCAA
>probe:Drosophila_2:1623933_at:138:157; Interrogation_Position=1412; Antisense; ACAACTTTCAGTCAAACCTTTTCAT
>probe:Drosophila_2:1623933_at:615:201; Interrogation_Position=1426; Antisense; AACCTTTTCATTTGTTGCAATGCTC
>probe:Drosophila_2:1623933_at:535:339; Interrogation_Position=1447; Antisense; GCTCAATTCATTAACAACCAACCAA
>probe:Drosophila_2:1623933_at:477:231; Interrogation_Position=1503; Antisense; AATGTTCATTGTTGTATATTACCGA
>probe:Drosophila_2:1623933_at:236:669; Interrogation_Position=1528; Antisense; TACTAACACAATCCAACATCCGCTT
>probe:Drosophila_2:1623933_at:368:291; Interrogation_Position=1548; Antisense; CGCTTACTCACCTCTAAATACAAAC
>probe:Drosophila_2:1623933_at:287:215; Interrogation_Position=1623; Antisense; AAGATAGACACCCAGTACATACCAA
>probe:Drosophila_2:1623933_at:614:299; Interrogation_Position=1633; Antisense; CCCAGTACATACCAACACACATATA
>probe:Drosophila_2:1623933_at:297:687; Interrogation_Position=1654; Antisense; TATATATATGCATACCACCTATTAT

Paste this into a BLAST search page for me
TCAATATTAATCACCCACACACGACCACATGCATATACAGTTGAACCGATAATGTTGCCATCATCATTTATGAGTCATTTATGAGTTGCCTGACATGATAACCCACAAACACAACTTTCAGTCAAACAACTTTCAGTCAAACCTTTTCATAACCTTTTCATTTGTTGCAATGCTCGCTCAATTCATTAACAACCAACCAAAATGTTCATTGTTGTATATTACCGATACTAACACAATCCAACATCCGCTTCGCTTACTCACCTCTAAATACAAACAAGATAGACACCCAGTACATACCAACCCAGTACATACCAACACACATATATATATATATGCATACCACCTATTAT

Full Affymetrix probeset data:

Annotations for 1623933_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime