FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623934_at:

>probe:Drosophila_2:1623934_at:546:443; Interrogation_Position=435; Antisense; GATGACCCCAAAAACGTGGACGCTA
>probe:Drosophila_2:1623934_at:151:519; Interrogation_Position=450; Antisense; GTGGACGCTATCACCAAGAACTACG
>probe:Drosophila_2:1623934_at:247:385; Interrogation_Position=467; Antisense; GAACTACGAGCATCTGTTTCAAGTC
>probe:Drosophila_2:1623934_at:286:479; Interrogation_Position=482; Antisense; GTTTCAAGTCAACGAACGCTCCAAA
>probe:Drosophila_2:1623934_at:169:169; Interrogation_Position=504; Antisense; AAAGGCGGCTCCTTCTATATCCAGT
>probe:Drosophila_2:1623934_at:71:213; Interrogation_Position=547; Antisense; AAGAGCGGCTGGACCATGAGATTAA
>probe:Drosophila_2:1623934_at:643:709; Interrogation_Position=568; Antisense; TTAAGGCCCATGAGCAGCCGAGGTC
>probe:Drosophila_2:1623934_at:415:431; Interrogation_Position=627; Antisense; GAGTCTCAGAGCAGATCGCGGCAGC
>probe:Drosophila_2:1623934_at:150:353; Interrogation_Position=647; Antisense; GCAGCGACGCTGAGTATCCTTGTTG
>probe:Drosophila_2:1623934_at:246:683; Interrogation_Position=661; Antisense; TATCCTTGTTGTCCCAATCGAACTA
>probe:Drosophila_2:1623934_at:433:375; Interrogation_Position=793; Antisense; GAAGAGCTCGACTTTCCAGGAACAC
>probe:Drosophila_2:1623934_at:45:177; Interrogation_Position=843; Antisense; AACACGGATTAGCTCAGGCGGTTAG
>probe:Drosophila_2:1623934_at:490:663; Interrogation_Position=871; Antisense; TAAATATTTTACTCTCAGGCCAGGT
>probe:Drosophila_2:1623934_at:153:293; Interrogation_Position=910; Antisense; CGATTTTAAGATCACGCTTCTTGGG

Paste this into a BLAST search page for me
GATGACCCCAAAAACGTGGACGCTAGTGGACGCTATCACCAAGAACTACGGAACTACGAGCATCTGTTTCAAGTCGTTTCAAGTCAACGAACGCTCCAAAAAAGGCGGCTCCTTCTATATCCAGTAAGAGCGGCTGGACCATGAGATTAATTAAGGCCCATGAGCAGCCGAGGTCGAGTCTCAGAGCAGATCGCGGCAGCGCAGCGACGCTGAGTATCCTTGTTGTATCCTTGTTGTCCCAATCGAACTAGAAGAGCTCGACTTTCCAGGAACACAACACGGATTAGCTCAGGCGGTTAGTAAATATTTTACTCTCAGGCCAGGTCGATTTTAAGATCACGCTTCTTGGG

Full Affymetrix probeset data:

Annotations for 1623934_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720