FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623935_at:

>probe:Drosophila_2:1623935_at:507:191; Interrogation_Position=1054; Antisense; AACGCCACGGCCACGGAGTTTGATT
>probe:Drosophila_2:1623935_at:682:549; Interrogation_Position=1068; Antisense; GGAGTTTGATTTTGTCTGCGACCAC
>probe:Drosophila_2:1623935_at:582:59; Interrogation_Position=1102; Antisense; ATGTTCTACTTTGCCGAGTCAGTCC
>probe:Drosophila_2:1623935_at:633:427; Interrogation_Position=1117; Antisense; GAGTCAGTCCGGCAACCGAAATCAT
>probe:Drosophila_2:1623935_at:516:239; Interrogation_Position=1136; Antisense; AATCATTTGCCGCATTGCGCTGCAG
>probe:Drosophila_2:1623935_at:625:617; Interrogation_Position=1156; Antisense; TGCAGCTCAGCGAAATCGGTGCTAT
>probe:Drosophila_2:1623935_at:689:53; Interrogation_Position=1233; Antisense; ATGCACCGGCAACGAGTTCATGGGC
>probe:Drosophila_2:1623935_at:307:509; Interrogation_Position=1259; Antisense; GTGAACCGGCAGTCCCCAAAAGAGG
>probe:Drosophila_2:1623935_at:85:483; Interrogation_Position=1283; Antisense; GTATCTTTTATCTGAGCACACGGCC
>probe:Drosophila_2:1623935_at:19:261; Interrogation_Position=1326; Antisense; CAGCGATGGGCTGGTCCACATTAAA
>probe:Drosophila_2:1623935_at:336:577; Interrogation_Position=1358; Antisense; GGCCGTCCACTATTCGGGAGACAGC
>probe:Drosophila_2:1623935_at:596:129; Interrogation_Position=1385; Antisense; ACCGGCGTTCAATTGGCTAGATCCA
>probe:Drosophila_2:1623935_at:422:559; Interrogation_Position=1417; Antisense; GGAAACCACGATTGCTACAGACCAA
>probe:Drosophila_2:1623935_at:329:169; Interrogation_Position=1565; Antisense; AAAGTGGATCACTCCGCAGGTTTAT

Paste this into a BLAST search page for me
AACGCCACGGCCACGGAGTTTGATTGGAGTTTGATTTTGTCTGCGACCACATGTTCTACTTTGCCGAGTCAGTCCGAGTCAGTCCGGCAACCGAAATCATAATCATTTGCCGCATTGCGCTGCAGTGCAGCTCAGCGAAATCGGTGCTATATGCACCGGCAACGAGTTCATGGGCGTGAACCGGCAGTCCCCAAAAGAGGGTATCTTTTATCTGAGCACACGGCCCAGCGATGGGCTGGTCCACATTAAAGGCCGTCCACTATTCGGGAGACAGCACCGGCGTTCAATTGGCTAGATCCAGGAAACCACGATTGCTACAGACCAAAAAGTGGATCACTCCGCAGGTTTAT

Full Affymetrix probeset data:

Annotations for 1623935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720