FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623936_at:

>probe:Drosophila_2:1623936_at:287:323; Interrogation_Position=127; Antisense; GCGCGGTGAATACTAATCCCAGCAA
>probe:Drosophila_2:1623936_at:41:265; Interrogation_Position=146; Antisense; CAGCAAGATCATGGTGGTCACACAC
>probe:Drosophila_2:1623936_at:224:519; Interrogation_Position=159; Antisense; GTGGTCACACACAACGTCAAGGGAT
>probe:Drosophila_2:1623936_at:98:171; Interrogation_Position=267; Antisense; AAAGGAGAGAGCTGGTGCCCCTACT
>probe:Drosophila_2:1623936_at:673:289; Interrogation_Position=301; Antisense; CGGAGCCGGTGATACACGATGCGCT
>probe:Drosophila_2:1623936_at:462:51; Interrogation_Position=319; Antisense; ATGCGCTGAAGAAGGCCCCGGGCAA
>probe:Drosophila_2:1623936_at:68:707; Interrogation_Position=32; Antisense; TTAGGAGAAGTCCATTCCCCTCCAG
>probe:Drosophila_2:1623936_at:244:255; Interrogation_Position=341; Antisense; CAACTCGCACTTCGTGCATGTGGAT
>probe:Drosophila_2:1623936_at:236:361; Interrogation_Position=409; Antisense; GCAAGGATCCCAACACGCATCTGAT
>probe:Drosophila_2:1623936_at:506:287; Interrogation_Position=455; Antisense; CTGGAAGCGGCCACAGCGTCTGGAT
>probe:Drosophila_2:1623936_at:322:337; Interrogation_Position=490; Antisense; GCTCCAATCAGGATCTCGTCGAGAT
>probe:Drosophila_2:1623936_at:669:375; Interrogation_Position=56; Antisense; GAAGCCAGTTACTCCAAAGTTCGCC
>probe:Drosophila_2:1623936_at:408:439; Interrogation_Position=606; Antisense; GATTCAATTAAAGCGTCCCTCAGTA
>probe:Drosophila_2:1623936_at:607:199; Interrogation_Position=95; Antisense; AACGCTTTTCGGTCGCATACTCAGA

Paste this into a BLAST search page for me
GCGCGGTGAATACTAATCCCAGCAACAGCAAGATCATGGTGGTCACACACGTGGTCACACACAACGTCAAGGGATAAAGGAGAGAGCTGGTGCCCCTACTCGGAGCCGGTGATACACGATGCGCTATGCGCTGAAGAAGGCCCCGGGCAATTAGGAGAAGTCCATTCCCCTCCAGCAACTCGCACTTCGTGCATGTGGATGCAAGGATCCCAACACGCATCTGATCTGGAAGCGGCCACAGCGTCTGGATGCTCCAATCAGGATCTCGTCGAGATGAAGCCAGTTACTCCAAAGTTCGCCGATTCAATTAAAGCGTCCCTCAGTAAACGCTTTTCGGTCGCATACTCAGA

Full Affymetrix probeset data:

Annotations for 1623936_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720