FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623940_at:

>probe:Drosophila_2:1623940_at:405:451; Interrogation_Position=1033; Antisense; GATCGTGGGACGTATTCTCTTTGAC
>probe:Drosophila_2:1623940_at:719:185; Interrogation_Position=1067; Antisense; AACACATTGCATCGTACTCTGCTTG
>probe:Drosophila_2:1623940_at:354:145; Interrogation_Position=1082; Antisense; ACTCTGCTTGGAGGTCTGACCTTTA
>probe:Drosophila_2:1623940_at:556:375; Interrogation_Position=1138; Antisense; GAAGCAGAAACAGTACGGCCGCCGC
>probe:Drosophila_2:1623940_at:499:377; Interrogation_Position=1165; Antisense; GAAGCGCCGAATTGTGGACTACACT
>probe:Drosophila_2:1623940_at:284:689; Interrogation_Position=1198; Antisense; TATTCGGAACTTCATGCACCGCAAC
>probe:Drosophila_2:1623940_at:645:169; Interrogation_Position=1251; Antisense; AAAGGCTGCCCGAGCAGAGGCCAGT
>probe:Drosophila_2:1623940_at:689:599; Interrogation_Position=1300; Antisense; TGTAATCACACGTCAACGCGGCGAT
>probe:Drosophila_2:1623940_at:59:3; Interrogation_Position=1351; Antisense; ATTGGATTCAACTGTAGGGCCACTT
>probe:Drosophila_2:1623940_at:75:523; Interrogation_Position=1367; Antisense; GGGCCACTTATTTTCTACGAGTTAT
>probe:Drosophila_2:1623940_at:179:245; Interrogation_Position=1407; Antisense; AATTGTTTTACCTCTTGCACTTTCA
>probe:Drosophila_2:1623940_at:649:723; Interrogation_Position=1421; Antisense; TTGCACTTTCAAGACGCTCACATCA
>probe:Drosophila_2:1623940_at:316:339; Interrogation_Position=1436; Antisense; GCTCACATCACCACCTAATTTAGGT
>probe:Drosophila_2:1623940_at:118:491; Interrogation_Position=1513; Antisense; GTACACTGTTTAATGGCCGGAAAAT

Paste this into a BLAST search page for me
GATCGTGGGACGTATTCTCTTTGACAACACATTGCATCGTACTCTGCTTGACTCTGCTTGGAGGTCTGACCTTTAGAAGCAGAAACAGTACGGCCGCCGCGAAGCGCCGAATTGTGGACTACACTTATTCGGAACTTCATGCACCGCAACAAAGGCTGCCCGAGCAGAGGCCAGTTGTAATCACACGTCAACGCGGCGATATTGGATTCAACTGTAGGGCCACTTGGGCCACTTATTTTCTACGAGTTATAATTGTTTTACCTCTTGCACTTTCATTGCACTTTCAAGACGCTCACATCAGCTCACATCACCACCTAATTTAGGTGTACACTGTTTAATGGCCGGAAAAT

Full Affymetrix probeset data:

Annotations for 1623940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720