FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623942_at:

>probe:Drosophila_2:1623942_at:504:19; Interrogation_Position=196; Antisense; ATATTGTACCGCATATCTACGGACT
>probe:Drosophila_2:1623942_at:36:583; Interrogation_Position=267; Antisense; TGGCGAGCAAACCTGTGTGCAGTTC
>probe:Drosophila_2:1623942_at:253:567; Interrogation_Position=319; Antisense; GGCAAACGATATGTGTCCTTCAAGA
>probe:Drosophila_2:1623942_at:654:501; Interrogation_Position=345; Antisense; GTCGCCCAATATGTGTGGCACTCGA
>probe:Drosophila_2:1623942_at:131:585; Interrogation_Position=360; Antisense; TGGCACTCGAGTGGGCTATCAACCT
>probe:Drosophila_2:1623942_at:33:729; Interrogation_Position=392; Antisense; TTGGTCCGCACGAAGTTGTCCTTAA
>probe:Drosophila_2:1623942_at:459:257; Interrogation_Position=429; Antisense; CACTATGCCGGCTGTAATTCAACAC
>probe:Drosophila_2:1623942_at:723:591; Interrogation_Position=470; Antisense; TGGGCCTTTTCCACGAGCAGAGTCG
>probe:Drosophila_2:1623942_at:686:99; Interrogation_Position=488; Antisense; AGAGTCGTCCCGATCGCGATGAGTA
>probe:Drosophila_2:1623942_at:195:143; Interrogation_Position=548; Antisense; ACTGGTCGCAGTTCATGGCCATGGA
>probe:Drosophila_2:1623942_at:296:545; Interrogation_Position=570; Antisense; GGATCAGACAACCACCTTCAATGTT
>probe:Drosophila_2:1623942_at:438:425; Interrogation_Position=607; Antisense; GAGAGCGTTATGCACTATTCGAAGA
>probe:Drosophila_2:1623942_at:368:541; Interrogation_Position=645; Antisense; GGATCCCTCAAAGCCAACAATTCGT
>probe:Drosophila_2:1623942_at:305:249; Interrogation_Position=662; Antisense; CAATTCGTGCCCTAATCGGTGGTAA

Paste this into a BLAST search page for me
ATATTGTACCGCATATCTACGGACTTGGCGAGCAAACCTGTGTGCAGTTCGGCAAACGATATGTGTCCTTCAAGAGTCGCCCAATATGTGTGGCACTCGATGGCACTCGAGTGGGCTATCAACCTTTGGTCCGCACGAAGTTGTCCTTAACACTATGCCGGCTGTAATTCAACACTGGGCCTTTTCCACGAGCAGAGTCGAGAGTCGTCCCGATCGCGATGAGTAACTGGTCGCAGTTCATGGCCATGGAGGATCAGACAACCACCTTCAATGTTGAGAGCGTTATGCACTATTCGAAGAGGATCCCTCAAAGCCAACAATTCGTCAATTCGTGCCCTAATCGGTGGTAA

Full Affymetrix probeset data:

Annotations for 1623942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720