Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623943_at:

>probe:Drosophila_2:1623943_at:624:185; Interrogation_Position=1123; Antisense; AACAATTTTATAGTCAGTGCATCCA
>probe:Drosophila_2:1623943_at:580:15; Interrogation_Position=1127; Antisense; ATTTTATAGTCAGTGCATCCAAGCA
>probe:Drosophila_2:1623943_at:681:495; Interrogation_Position=1135; Antisense; GTCAGTGCATCCAAGCAACTGTTTT
>probe:Drosophila_2:1623943_at:110:85; Interrogation_Position=1138; Antisense; AGTGCATCCAAGCAACTGTTTTTGG
>probe:Drosophila_2:1623943_at:282:253; Interrogation_Position=1146; Antisense; CAAGCAACTGTTTTTGGTGGTCTAG
>probe:Drosophila_2:1623943_at:607:359; Interrogation_Position=1149; Antisense; GCAACTGTTTTTGGTGGTCTAGTAT
>probe:Drosophila_2:1623943_at:231:533; Interrogation_Position=1161; Antisense; GGTGGTCTAGTATTGTTGACGGCAT
>probe:Drosophila_2:1623943_at:571:643; Interrogation_Position=1166; Antisense; TCTAGTATTGTTGACGGCATTGAAA
>probe:Drosophila_2:1623943_at:442:5; Interrogation_Position=1172; Antisense; ATTGTTGACGGCATTGAAACCGGAT
>probe:Drosophila_2:1623943_at:448:407; Interrogation_Position=1178; Antisense; GACGGCATTGAAACCGGATAATTTA
>probe:Drosophila_2:1623943_at:144:1; Interrogation_Position=1202; Antisense; AAAACATTTATTATTGAGGTAGGCA
>probe:Drosophila_2:1623943_at:100:425; Interrogation_Position=1217; Antisense; GAGGTAGGCAAAAATAGTCCTGTAA
>probe:Drosophila_2:1623943_at:279:563; Interrogation_Position=1223; Antisense; GGCAAAAATAGTCCTGTAATAAATT
>probe:Drosophila_2:1623943_at:5:363; Interrogation_Position=984; Antisense; GAATTGACCAATATAAGCACTAATA

Paste this into a BLAST search page for me
AACAATTTTATAGTCAGTGCATCCAATTTTATAGTCAGTGCATCCAAGCAGTCAGTGCATCCAAGCAACTGTTTTAGTGCATCCAAGCAACTGTTTTTGGCAAGCAACTGTTTTTGGTGGTCTAGGCAACTGTTTTTGGTGGTCTAGTATGGTGGTCTAGTATTGTTGACGGCATTCTAGTATTGTTGACGGCATTGAAAATTGTTGACGGCATTGAAACCGGATGACGGCATTGAAACCGGATAATTTAAAAACATTTATTATTGAGGTAGGCAGAGGTAGGCAAAAATAGTCCTGTAAGGCAAAAATAGTCCTGTAATAAATTGAATTGACCAATATAAGCACTAATA

Full Affymetrix probeset data:

Annotations for 1623943_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime