FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623944_at:

>probe:Drosophila_2:1623944_at:17:523; Interrogation_Position=3943; Antisense; GTGGCGAAGGAATCGCGACCCCAAT
>probe:Drosophila_2:1623944_at:451:325; Interrogation_Position=3957; Antisense; GCGACCCCAATTAAGACATTCTCAT
>probe:Drosophila_2:1623944_at:700:401; Interrogation_Position=3971; Antisense; GACATTCTCATACACATGCAACAAA
>probe:Drosophila_2:1623944_at:32:697; Interrogation_Position=4020; Antisense; TTTTATTACTAGCATTAGAGTCCCC
>probe:Drosophila_2:1623944_at:16:133; Interrogation_Position=4048; Antisense; ACCCCCGTCGTGTACATACATATAT
>probe:Drosophila_2:1623944_at:517:659; Interrogation_Position=4072; Antisense; TAAGCTCCACATGAAATGCAAGTTT
>probe:Drosophila_2:1623944_at:295:729; Interrogation_Position=4148; Antisense; TTGGCCCAGCCAAAGGTTTCTAATG
>probe:Drosophila_2:1623944_at:182:657; Interrogation_Position=4168; Antisense; TAATGGACAGGAACACACCTCCTTC
>probe:Drosophila_2:1623944_at:199:185; Interrogation_Position=4201; Antisense; AAAAGGATATACATGCATAGGCAAA
>probe:Drosophila_2:1623944_at:668:23; Interrogation_Position=4241; Antisense; ATATCCCAATATACCCAATGTTCTG
>probe:Drosophila_2:1623944_at:234:27; Interrogation_Position=4251; Antisense; ATACCCAATGTTCTGGGAGGTCGAA
>probe:Drosophila_2:1623944_at:626:443; Interrogation_Position=4311; Antisense; GATGATAGATGTAGAAGACGCACTT
>probe:Drosophila_2:1623944_at:265:485; Interrogation_Position=4321; Antisense; GTAGAAGACGCACTTGTAAAACAAA
>probe:Drosophila_2:1623944_at:629:209; Interrogation_Position=4356; Antisense; AAGCAATTCCAAAGTTAAGTGACAT

Paste this into a BLAST search page for me
GTGGCGAAGGAATCGCGACCCCAATGCGACCCCAATTAAGACATTCTCATGACATTCTCATACACATGCAACAAATTTTATTACTAGCATTAGAGTCCCCACCCCCGTCGTGTACATACATATATTAAGCTCCACATGAAATGCAAGTTTTTGGCCCAGCCAAAGGTTTCTAATGTAATGGACAGGAACACACCTCCTTCAAAAGGATATACATGCATAGGCAAAATATCCCAATATACCCAATGTTCTGATACCCAATGTTCTGGGAGGTCGAAGATGATAGATGTAGAAGACGCACTTGTAGAAGACGCACTTGTAAAACAAAAAGCAATTCCAAAGTTAAGTGACAT

Full Affymetrix probeset data:

Annotations for 1623944_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720