FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623947_at:

>probe:Drosophila_2:1623947_at:345:101; Interrogation_Position=1077; Antisense; AGAGTTTTCCCTGCTCTACATGAAT
>probe:Drosophila_2:1623947_at:337:597; Interrogation_Position=1128; Antisense; TGTGAGACGTCTGCACATCGTTGGA
>probe:Drosophila_2:1623947_at:43:661; Interrogation_Position=1172; Antisense; TAACCGTTCACAACATGACCAGAAG
>probe:Drosophila_2:1623947_at:594:127; Interrogation_Position=1204; Antisense; ACCAATGTGTTAGTTCTGTGTCAGA
>probe:Drosophila_2:1623947_at:530:451; Interrogation_Position=652; Antisense; GATCTAGAGGTCTTGCCCGAACGGA
>probe:Drosophila_2:1623947_at:715:591; Interrogation_Position=695; Antisense; TGGGACTGATGCAAATCCTTGCCGC
>probe:Drosophila_2:1623947_at:382:625; Interrogation_Position=714; Antisense; TGCCGCCTGGCGAAAACTTTGGAGA
>probe:Drosophila_2:1623947_at:674:729; Interrogation_Position=732; Antisense; TTGGAGACGCTGTCGCCGTTTGGAT
>probe:Drosophila_2:1623947_at:220:481; Interrogation_Position=749; Antisense; GTTTGGATGCGTTGCTCAAGCAGTT
>probe:Drosophila_2:1623947_at:207:209; Interrogation_Position=766; Antisense; AAGCAGTTCGTTGACATCTTCCAGT
>probe:Drosophila_2:1623947_at:398:645; Interrogation_Position=800; Antisense; TCTTCAACCTGCTAACCACTTATAT
>probe:Drosophila_2:1623947_at:348:649; Interrogation_Position=827; Antisense; TCAGCATTGCTGTTTTGTTTCGATT
>probe:Drosophila_2:1623947_at:600:327; Interrogation_Position=907; Antisense; GCGATTATTTTTCTGACCCATCACG
>probe:Drosophila_2:1623947_at:54:719; Interrogation_Position=951; Antisense; TTCCATTTTCGAGATCAACCGCTGT

Paste this into a BLAST search page for me
AGAGTTTTCCCTGCTCTACATGAATTGTGAGACGTCTGCACATCGTTGGATAACCGTTCACAACATGACCAGAAGACCAATGTGTTAGTTCTGTGTCAGAGATCTAGAGGTCTTGCCCGAACGGATGGGACTGATGCAAATCCTTGCCGCTGCCGCCTGGCGAAAACTTTGGAGATTGGAGACGCTGTCGCCGTTTGGATGTTTGGATGCGTTGCTCAAGCAGTTAAGCAGTTCGTTGACATCTTCCAGTTCTTCAACCTGCTAACCACTTATATTCAGCATTGCTGTTTTGTTTCGATTGCGATTATTTTTCTGACCCATCACGTTCCATTTTCGAGATCAACCGCTGT

Full Affymetrix probeset data:

Annotations for 1623947_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720