FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623951_at:

>probe:Drosophila_2:1623951_at:240:171; Interrogation_Position=109; Antisense; AAAGTGGGCAGCAGCGTAACGCTCA
>probe:Drosophila_2:1623951_at:47:151; Interrogation_Position=133; Antisense; ACTTGTCACGTGAAGCAGCCGGCGA
>probe:Drosophila_2:1623951_at:501:553; Interrogation_Position=15; Antisense; GGAGCTCCACAAGCAGTACACAACT
>probe:Drosophila_2:1623951_at:344:3; Interrogation_Position=172; Antisense; ATTGGGCCAATTTACTGGTATCGCG
>probe:Drosophila_2:1623951_at:661:459; Interrogation_Position=247; Antisense; GATTTGCAGCGCATCTCCATGGAGT
>probe:Drosophila_2:1623951_at:80:589; Interrogation_Position=266; Antisense; TGGAGTCCACGCTGGCCGAGAAGCT
>probe:Drosophila_2:1623951_at:411:377; Interrogation_Position=285; Antisense; GAAGCTCCAGAGCAGATTACGCATT
>probe:Drosophila_2:1623951_at:175:9; Interrogation_Position=307; Antisense; ATTGCCAATGCTCAGCTGCTGGACA
>probe:Drosophila_2:1623951_at:15:561; Interrogation_Position=334; Antisense; GGAAACTATACGTGCATGCCGACCA
>probe:Drosophila_2:1623951_at:499:309; Interrogation_Position=371; Antisense; CCAGCGTGGTGGTCAATGTCATCAA
>probe:Drosophila_2:1623951_at:131:589; Interrogation_Position=396; Antisense; TGGTAAGAGCGGTTCGGACTCCGAA
>probe:Drosophila_2:1623951_at:438:339; Interrogation_Position=46; Antisense; GCTAGCATGTTAACGCCGCCAGATG
>probe:Drosophila_2:1623951_at:83:223; Interrogation_Position=73; Antisense; AAGGCGATTATTGCCGGACCGACGG
>probe:Drosophila_2:1623951_at:554:369; Interrogation_Position=89; Antisense; GACCGACGGACCTCTATGTCAAAGT

Paste this into a BLAST search page for me
AAAGTGGGCAGCAGCGTAACGCTCAACTTGTCACGTGAAGCAGCCGGCGAGGAGCTCCACAAGCAGTACACAACTATTGGGCCAATTTACTGGTATCGCGGATTTGCAGCGCATCTCCATGGAGTTGGAGTCCACGCTGGCCGAGAAGCTGAAGCTCCAGAGCAGATTACGCATTATTGCCAATGCTCAGCTGCTGGACAGGAAACTATACGTGCATGCCGACCACCAGCGTGGTGGTCAATGTCATCAATGGTAAGAGCGGTTCGGACTCCGAAGCTAGCATGTTAACGCCGCCAGATGAAGGCGATTATTGCCGGACCGACGGGACCGACGGACCTCTATGTCAAAGT

Full Affymetrix probeset data:

Annotations for 1623951_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720