FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623953_at:

>probe:Drosophila_2:1623953_at:76:17; Interrogation_Position=1099; Antisense; ATTTTGGCGCACTTTATGCCTGAGA
>probe:Drosophila_2:1623953_at:625:129; Interrogation_Position=1129; Antisense; TACCTAAACCGCATACCACAGTGGA
>probe:Drosophila_2:1623953_at:711:299; Interrogation_Position=1163; Antisense; CCCGTCTTTGGAGGTGGCGTCACTT
>probe:Drosophila_2:1623953_at:728:273; Interrogation_Position=1185; Antisense; CTTGGGATTGAGACTGCGCCGGAAT
>probe:Drosophila_2:1623953_at:311:563; Interrogation_Position=1205; Antisense; GGAATCTGCTGTTTAACCGCTTCGA
>probe:Drosophila_2:1623953_at:533:201; Interrogation_Position=1219; Antisense; AACCGCTTCGACAATGGTGGCGCAG
>probe:Drosophila_2:1623953_at:61:547; Interrogation_Position=1278; Antisense; GGATCGTCTGGGAATTATGGCTTAC
>probe:Drosophila_2:1623953_at:475:681; Interrogation_Position=1293; Antisense; TATGGCTTACGATCCGGAAAGTGGC
>probe:Drosophila_2:1623953_at:204:123; Interrogation_Position=1328; Antisense; AGCGAGCCTTTGACAATCCGATGTT
>probe:Drosophila_2:1623953_at:52:439; Interrogation_Position=1402; Antisense; GATGAAATCCTGAGTGTCCCCAAAA
>probe:Drosophila_2:1623953_at:233:229; Interrogation_Position=1425; Antisense; AATGGAGACTGGTGATCTGGACGCC
>probe:Drosophila_2:1623953_at:65:33; Interrogation_Position=1483; Antisense; ATCAATTTGGAAACCTGCGAGGCGG
>probe:Drosophila_2:1623953_at:613:557; Interrogation_Position=1506; Antisense; GGACACCGACGAGGAGACCATCTAA
>probe:Drosophila_2:1623953_at:693:391; Interrogation_Position=1556; Antisense; GAAACCTGATTCGAAAGCACCAATG

Paste this into a BLAST search page for me
ATTTTGGCGCACTTTATGCCTGAGATACCTAAACCGCATACCACAGTGGACCCGTCTTTGGAGGTGGCGTCACTTCTTGGGATTGAGACTGCGCCGGAATGGAATCTGCTGTTTAACCGCTTCGAAACCGCTTCGACAATGGTGGCGCAGGGATCGTCTGGGAATTATGGCTTACTATGGCTTACGATCCGGAAAGTGGCAGCGAGCCTTTGACAATCCGATGTTGATGAAATCCTGAGTGTCCCCAAAAAATGGAGACTGGTGATCTGGACGCCATCAATTTGGAAACCTGCGAGGCGGGGACACCGACGAGGAGACCATCTAAGAAACCTGATTCGAAAGCACCAATG

Full Affymetrix probeset data:

Annotations for 1623953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720