FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623955_at:

>probe:Drosophila_2:1623955_at:72:633; Interrogation_Position=3356; Antisense; TCGCGGTTTCTTCGCCATACGTAAG
>probe:Drosophila_2:1623955_at:647:653; Interrogation_Position=3377; Antisense; TAAGAAGGATCCACTCAACCGACTG
>probe:Drosophila_2:1623955_at:544:501; Interrogation_Position=3410; Antisense; GTCGACCTGCTTCAATCTGCTGAAG
>probe:Drosophila_2:1623955_at:58:379; Interrogation_Position=3431; Antisense; GAAGCTGCCCAACTACCAAAAGAAG
>probe:Drosophila_2:1623955_at:341:371; Interrogation_Position=3452; Antisense; GAAGTCCACGCTGCGGGACAAACTT
>probe:Drosophila_2:1623955_at:159:397; Interrogation_Position=3468; Antisense; GACAAACTTCGCTATGCCGTAAGCA
>probe:Drosophila_2:1623955_at:595:291; Interrogation_Position=3485; Antisense; CGTAAGCAGCAACACCGGATTCGAG
>probe:Drosophila_2:1623955_at:568:129; Interrogation_Position=3498; Antisense; ACCGGATTCGAGCTGTCCTAAAACA
>probe:Drosophila_2:1623955_at:55:343; Interrogation_Position=3523; Antisense; GCTTGAAATATTCCCCTACTTCTTA
>probe:Drosophila_2:1623955_at:395:481; Interrogation_Position=3580; Antisense; GTATTCTTTCGTAGGCAATTTGGTG
>probe:Drosophila_2:1623955_at:448:651; Interrogation_Position=3615; Antisense; TCAAATATTTTTGTGGCCGCATCAC
>probe:Drosophila_2:1623955_at:672:577; Interrogation_Position=3629; Antisense; GGCCGCATCACAAACGGATTGAGAA
>probe:Drosophila_2:1623955_at:36:251; Interrogation_Position=3782; Antisense; CAATCCATTGTGTTGGCTGATGATA
>probe:Drosophila_2:1623955_at:412:19; Interrogation_Position=3858; Antisense; ATATCTAACCCACGTACGGTGTAAG

Paste this into a BLAST search page for me
TCGCGGTTTCTTCGCCATACGTAAGTAAGAAGGATCCACTCAACCGACTGGTCGACCTGCTTCAATCTGCTGAAGGAAGCTGCCCAACTACCAAAAGAAGGAAGTCCACGCTGCGGGACAAACTTGACAAACTTCGCTATGCCGTAAGCACGTAAGCAGCAACACCGGATTCGAGACCGGATTCGAGCTGTCCTAAAACAGCTTGAAATATTCCCCTACTTCTTAGTATTCTTTCGTAGGCAATTTGGTGTCAAATATTTTTGTGGCCGCATCACGGCCGCATCACAAACGGATTGAGAACAATCCATTGTGTTGGCTGATGATAATATCTAACCCACGTACGGTGTAAG

Full Affymetrix probeset data:

Annotations for 1623955_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720