Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623956_at:

>probe:Drosophila_2:1623956_at:80:141; Interrogation_Position=1776; Antisense; ACGTGGAGGCCATTATAGCCCAGGC
>probe:Drosophila_2:1623956_at:114:351; Interrogation_Position=1812; Antisense; GCAGAAAACTGCTTTATGTCGAGAG
>probe:Drosophila_2:1623956_at:367:351; Interrogation_Position=1922; Antisense; GCAGATGATGCCGAACCCAAGGTGA
>probe:Drosophila_2:1623956_at:288:319; Interrogation_Position=2000; Antisense; GCTCCGTTGGTCTCCGGAATCGAGG
>probe:Drosophila_2:1623956_at:44:439; Interrogation_Position=2024; Antisense; GAGGCCGGCATGCACATTGTATTGA
>probe:Drosophila_2:1623956_at:324:67; Interrogation_Position=2067; Antisense; ATGGCAAGCGAGAGGGCACCCCGTT
>probe:Drosophila_2:1623956_at:275:127; Interrogation_Position=2093; Antisense; AGCCAACAGCTACTCCAAAACTTGT
>probe:Drosophila_2:1623956_at:715:181; Interrogation_Position=2109; Antisense; AAAACTTGTCCTCCGATGTGCTGAA
>probe:Drosophila_2:1623956_at:374:601; Interrogation_Position=2159; Antisense; TGTTTTGTCCTGCTCAAGCTGGTGG
>probe:Drosophila_2:1623956_at:205:101; Interrogation_Position=2232; Antisense; AGAGGAGCCTTAGCCAGATACTCGC
>probe:Drosophila_2:1623956_at:8:95; Interrogation_Position=2247; Antisense; AGATACTCGCGGACCGTAAGACGCC
>probe:Drosophila_2:1623956_at:178:491; Interrogation_Position=2262; Antisense; GTAAGACGCCCGGAGCCAAGCTACT
>probe:Drosophila_2:1623956_at:540:669; Interrogation_Position=2283; Antisense; TACTGGCCGCCAAACTGGACATTGG
>probe:Drosophila_2:1623956_at:159:607; Interrogation_Position=2312; Antisense; TGAGAAACGCTTCTAGCCTAGACAA

Paste this into a BLAST search page for me
ACGTGGAGGCCATTATAGCCCAGGCGCAGAAAACTGCTTTATGTCGAGAGGCAGATGATGCCGAACCCAAGGTGAGCTCCGTTGGTCTCCGGAATCGAGGGAGGCCGGCATGCACATTGTATTGAATGGCAAGCGAGAGGGCACCCCGTTAGCCAACAGCTACTCCAAAACTTGTAAAACTTGTCCTCCGATGTGCTGAATGTTTTGTCCTGCTCAAGCTGGTGGAGAGGAGCCTTAGCCAGATACTCGCAGATACTCGCGGACCGTAAGACGCCGTAAGACGCCCGGAGCCAAGCTACTTACTGGCCGCCAAACTGGACATTGGTGAGAAACGCTTCTAGCCTAGACAA

Full Affymetrix probeset data:

Annotations for 1623956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime