Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623959_at:

>probe:Drosophila_2:1623959_at:428:449; Interrogation_Position=498; Antisense; GATCCTGTCCAATCGGTGGAGCTTA
>probe:Drosophila_2:1623959_at:276:111; Interrogation_Position=528; Antisense; AGCAATCTTCAAAACTCGCGCAAAT
>probe:Drosophila_2:1623959_at:586:385; Interrogation_Position=621; Antisense; GAACAGCAGGCTTCACTGGAGATCA
>probe:Drosophila_2:1623959_at:278:313; Interrogation_Position=719; Antisense; GCCACCTCTCCAAGAAGCGGTTAAA
>probe:Drosophila_2:1623959_at:547:661; Interrogation_Position=763; Antisense; TAACACCTCTGATTACCCTGGATAC
>probe:Drosophila_2:1623959_at:614:535; Interrogation_Position=782; Antisense; GGATACGCCAGGAAAGGCCACCGTT
>probe:Drosophila_2:1623959_at:49:533; Interrogation_Position=809; Antisense; GGTGGTAATTCTCGGTGACCCCGAT
>probe:Drosophila_2:1623959_at:717:411; Interrogation_Position=825; Antisense; GACCCCGATGGTCATGAGATCTGCT
>probe:Drosophila_2:1623959_at:201:57; Interrogation_Position=838; Antisense; ATGAGATCTGCTTTGTCGACGAGGA
>probe:Drosophila_2:1623959_at:299:717; Interrogation_Position=867; Antisense; TTCGGCCAGCTATCTCAGGTGGAGT
>probe:Drosophila_2:1623959_at:18:449; Interrogation_Position=930; Antisense; GATCCCTTCCAACCGAAATGACTTT
>probe:Drosophila_2:1623959_at:574:163; Interrogation_Position=945; Antisense; AAATGACTTTCCCAGCAATCCTTGA
>probe:Drosophila_2:1623959_at:13:361; Interrogation_Position=959; Antisense; GCAATCCTTGAGCACTGTTATTTGT
>probe:Drosophila_2:1623959_at:424:475; Interrogation_Position=975; Antisense; GTTATTTGTACACAGCACCTTTTGT

Paste this into a BLAST search page for me
GATCCTGTCCAATCGGTGGAGCTTAAGCAATCTTCAAAACTCGCGCAAATGAACAGCAGGCTTCACTGGAGATCAGCCACCTCTCCAAGAAGCGGTTAAATAACACCTCTGATTACCCTGGATACGGATACGCCAGGAAAGGCCACCGTTGGTGGTAATTCTCGGTGACCCCGATGACCCCGATGGTCATGAGATCTGCTATGAGATCTGCTTTGTCGACGAGGATTCGGCCAGCTATCTCAGGTGGAGTGATCCCTTCCAACCGAAATGACTTTAAATGACTTTCCCAGCAATCCTTGAGCAATCCTTGAGCACTGTTATTTGTGTTATTTGTACACAGCACCTTTTGT

Full Affymetrix probeset data:

Annotations for 1623959_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime