FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623961_at:

>probe:Drosophila_2:1623961_at:202:527; Interrogation_Position=135; Antisense; GGGAATATGGCCCTTCTACCACTAC
>probe:Drosophila_2:1623961_at:278:75; Interrogation_Position=173; Antisense; AGGACCAGCGCCCACTGTTGATATT
>probe:Drosophila_2:1623961_at:539:459; Interrogation_Position=192; Antisense; GATATTCCCAACGACATCATCGATG
>probe:Drosophila_2:1623961_at:94:445; Interrogation_Position=213; Antisense; GATGAGTCACTCTACTTCTGGAAAT
>probe:Drosophila_2:1623961_at:377:237; Interrogation_Position=235; Antisense; AATCGAACATTTTCTTCCGCACTTA
>probe:Drosophila_2:1623961_at:216:559; Interrogation_Position=278; Antisense; GGACAGGGTGCTCATCTACATAACG
>probe:Drosophila_2:1623961_at:392:693; Interrogation_Position=320; Antisense; TTTGAAGCGATTGGCCCGATGCACA
>probe:Drosophila_2:1623961_at:36:167; Interrogation_Position=348; Antisense; AAATCGCAGGGTCAGCAGGAGCTCT
>probe:Drosophila_2:1623961_at:359:115; Interrogation_Position=361; Antisense; AGCAGGAGCTCTATACGCTGGCCAT
>probe:Drosophila_2:1623961_at:239:119; Interrogation_Position=457; Antisense; AGCTGATGCGTCAGTACTTCCTGCA
>probe:Drosophila_2:1623961_at:647:613; Interrogation_Position=478; Antisense; TGCAGTTGCGCCAGGAAACCGGAAA
>probe:Drosophila_2:1623961_at:578:147; Interrogation_Position=515; Antisense; AAAGGTCTTTGATACTCCGGATGGA
>probe:Drosophila_2:1623961_at:554:403; Interrogation_Position=617; Antisense; GACTCACTAATATACTGCCGATCTT
>probe:Drosophila_2:1623961_at:409:165; Interrogation_Position=88; Antisense; AAATGCCGGCATTTCACTCGGAAAT

Paste this into a BLAST search page for me
GGGAATATGGCCCTTCTACCACTACAGGACCAGCGCCCACTGTTGATATTGATATTCCCAACGACATCATCGATGGATGAGTCACTCTACTTCTGGAAATAATCGAACATTTTCTTCCGCACTTAGGACAGGGTGCTCATCTACATAACGTTTGAAGCGATTGGCCCGATGCACAAAATCGCAGGGTCAGCAGGAGCTCTAGCAGGAGCTCTATACGCTGGCCATAGCTGATGCGTCAGTACTTCCTGCATGCAGTTGCGCCAGGAAACCGGAAAAAAGGTCTTTGATACTCCGGATGGAGACTCACTAATATACTGCCGATCTTAAATGCCGGCATTTCACTCGGAAAT

Full Affymetrix probeset data:

Annotations for 1623961_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720