Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623963_at:

>probe:Drosophila_2:1623963_at:529:719; Interrogation_Position=1000; Antisense; TTCCAATCTTTCAGCTCCTTAAAGC
>probe:Drosophila_2:1623963_at:285:433; Interrogation_Position=1131; Antisense; GAGTGCGGATTTTATGATCCTAAAA
>probe:Drosophila_2:1623963_at:110:207; Interrogation_Position=1154; Antisense; AAGCGTTAGCCATTTTGTACAACAC
>probe:Drosophila_2:1623963_at:378:491; Interrogation_Position=1170; Antisense; GTACAACACCCAAATCTTAAACGAT
>probe:Drosophila_2:1623963_at:502:707; Interrogation_Position=1222; Antisense; TTACCGATGATTATGCAGCTTTGCT
>probe:Drosophila_2:1623963_at:47:555; Interrogation_Position=1331; Antisense; GGACATTCTTCGGTCGGGTAACTGT
>probe:Drosophila_2:1623963_at:164:401; Interrogation_Position=1427; Antisense; GACATTGGACCGGTTTTTAGCGCTC
>probe:Drosophila_2:1623963_at:434:323; Interrogation_Position=1446; Antisense; GCGCTCGGTGTGGAACTGATAGACT
>probe:Drosophila_2:1623963_at:219:277; Interrogation_Position=1469; Antisense; CTATAACAGTGCAAGTTCGGGCCTT
>probe:Drosophila_2:1623963_at:311:717; Interrogation_Position=1484; Antisense; TTCGGGCCTTGAGTCTGTTTCTGAT
>probe:Drosophila_2:1623963_at:496:285; Interrogation_Position=1498; Antisense; CTGTTTCTGATTCTGGCCCAGATTA
>probe:Drosophila_2:1623963_at:545:475; Interrogation_Position=1525; Antisense; GTTTTCTTTGGAACCATTCGGATGA
>probe:Drosophila_2:1623963_at:655:547; Interrogation_Position=972; Antisense; GGAGCAGTCTCAACTTATACGCGGT
>probe:Drosophila_2:1623963_at:690:701; Interrogation_Position=986; Antisense; TTATACGCGGTCCATTCCAATCTTT

Paste this into a BLAST search page for me
TTCCAATCTTTCAGCTCCTTAAAGCGAGTGCGGATTTTATGATCCTAAAAAAGCGTTAGCCATTTTGTACAACACGTACAACACCCAAATCTTAAACGATTTACCGATGATTATGCAGCTTTGCTGGACATTCTTCGGTCGGGTAACTGTGACATTGGACCGGTTTTTAGCGCTCGCGCTCGGTGTGGAACTGATAGACTCTATAACAGTGCAAGTTCGGGCCTTTTCGGGCCTTGAGTCTGTTTCTGATCTGTTTCTGATTCTGGCCCAGATTAGTTTTCTTTGGAACCATTCGGATGAGGAGCAGTCTCAACTTATACGCGGTTTATACGCGGTCCATTCCAATCTTT

Full Affymetrix probeset data:

Annotations for 1623963_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime