FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623964_at:

>probe:Drosophila_2:1623964_at:583:563; Interrogation_Position=1086; Antisense; GGAATCCCAGTATCCGCACAATATT
>probe:Drosophila_2:1623964_at:529:429; Interrogation_Position=1121; Antisense; GAGTTATGTCGCTTTCCGTGAGAAC
>probe:Drosophila_2:1623964_at:485:423; Interrogation_Position=1140; Antisense; GAGAACGGCTCTGCAGATTGTTAAA
>probe:Drosophila_2:1623964_at:73:459; Interrogation_Position=610; Antisense; GATTTGTTCGTATTTCTCGGCTTAA
>probe:Drosophila_2:1623964_at:678:639; Interrogation_Position=626; Antisense; TCGGCTTAACGCAGATCCTAACTTT
>probe:Drosophila_2:1623964_at:594:191; Interrogation_Position=645; Antisense; AACTTTCGCCGATATGCTGCAGGTG
>probe:Drosophila_2:1623964_at:42:493; Interrogation_Position=761; Antisense; GTCAACGCCTTCTCTTGGATGTTAT
>probe:Drosophila_2:1623964_at:226:245; Interrogation_Position=797; Antisense; AATTATTCACGGACTACTGTCGCGC
>probe:Drosophila_2:1623964_at:691:231; Interrogation_Position=826; Antisense; AATGCCCTCTACTACGAATTGATCG
>probe:Drosophila_2:1623964_at:636:361; Interrogation_Position=841; Antisense; GAATTGATCGCCACTCAGGTTCTTT
>probe:Drosophila_2:1623964_at:694:19; Interrogation_Position=902; Antisense; ATTTGAGCAGCTTTCACATGCCTTC
>probe:Drosophila_2:1623964_at:35:39; Interrogation_Position=931; Antisense; ATCTTTTTCGTGGTTTCTGCCTACA
>probe:Drosophila_2:1623964_at:65:63; Interrogation_Position=958; Antisense; ATGTCCATCTATTGCATTCTGGGCA
>probe:Drosophila_2:1623964_at:81:567; Interrogation_Position=979; Antisense; GGCACCATTCTTGAGTTTGCATATG

Paste this into a BLAST search page for me
GGAATCCCAGTATCCGCACAATATTGAGTTATGTCGCTTTCCGTGAGAACGAGAACGGCTCTGCAGATTGTTAAAGATTTGTTCGTATTTCTCGGCTTAATCGGCTTAACGCAGATCCTAACTTTAACTTTCGCCGATATGCTGCAGGTGGTCAACGCCTTCTCTTGGATGTTATAATTATTCACGGACTACTGTCGCGCAATGCCCTCTACTACGAATTGATCGGAATTGATCGCCACTCAGGTTCTTTATTTGAGCAGCTTTCACATGCCTTCATCTTTTTCGTGGTTTCTGCCTACAATGTCCATCTATTGCATTCTGGGCAGGCACCATTCTTGAGTTTGCATATG

Full Affymetrix probeset data:

Annotations for 1623964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720