Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623967_at:

>probe:Drosophila_2:1623967_at:414:339; Interrogation_Position=1040; Antisense; GCTCACAGCGGAGGTGTGGTTCCAT
>probe:Drosophila_2:1623967_at:433:269; Interrogation_Position=1062; Antisense; CATGCGGGCATATCCAGACCAATAT
>probe:Drosophila_2:1623967_at:425:103; Interrogation_Position=1077; Antisense; AGACCAATATCGGAGCGTTTGCTGC
>probe:Drosophila_2:1623967_at:619:723; Interrogation_Position=1095; Antisense; TTGCTGCAGCAGGACGGCGACTTTC
>probe:Drosophila_2:1623967_at:421:697; Interrogation_Position=1116; Antisense; TTTCTGGTGCGCGAGTCACAGGGAA
>probe:Drosophila_2:1623967_at:598:577; Interrogation_Position=1146; Antisense; GGCCAGTACGTACTAACCGGATTAG
>probe:Drosophila_2:1623967_at:510:535; Interrogation_Position=1217; Antisense; GGTCCGAACCAAAGATCGCATCTTC
>probe:Drosophila_2:1623967_at:59:635; Interrogation_Position=1232; Antisense; TCGCATCTTCGACAGCATTAGCCAT
>probe:Drosophila_2:1623967_at:557:77; Interrogation_Position=1300; Antisense; AGGATTCCGAGCTGGTCTTGCGTAA
>probe:Drosophila_2:1623967_at:161:591; Interrogation_Position=1312; Antisense; TGGTCTTGCGTAATCCGGTGCGAAG
>probe:Drosophila_2:1623967_at:447:33; Interrogation_Position=1370; Antisense; ATCAGCATCTTCCTGAACCGGAGGG
>probe:Drosophila_2:1623967_at:593:675; Interrogation_Position=1409; Antisense; TAGCTACCACCCATCATATACATAA
>probe:Drosophila_2:1623967_at:311:687; Interrogation_Position=1446; Antisense; TATACTGGCATCAGCGTACACGATT
>probe:Drosophila_2:1623967_at:181:509; Interrogation_Position=1572; Antisense; GTGCATGTCTACAGTATTTTCCATT

Paste this into a BLAST search page for me
GCTCACAGCGGAGGTGTGGTTCCATCATGCGGGCATATCCAGACCAATATAGACCAATATCGGAGCGTTTGCTGCTTGCTGCAGCAGGACGGCGACTTTCTTTCTGGTGCGCGAGTCACAGGGAAGGCCAGTACGTACTAACCGGATTAGGGTCCGAACCAAAGATCGCATCTTCTCGCATCTTCGACAGCATTAGCCATAGGATTCCGAGCTGGTCTTGCGTAATGGTCTTGCGTAATCCGGTGCGAAGATCAGCATCTTCCTGAACCGGAGGGTAGCTACCACCCATCATATACATAATATACTGGCATCAGCGTACACGATTGTGCATGTCTACAGTATTTTCCATT

Full Affymetrix probeset data:

Annotations for 1623967_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime