Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623968_at:

>probe:Drosophila_2:1623968_at:490:209; Interrogation_Position=11514; Antisense; AAGCACATCTGCTGTCGTCACTTTG
>probe:Drosophila_2:1623968_at:458:495; Interrogation_Position=11530; Antisense; GTCACTTTGAGTCGCATTGCTTCCT
>probe:Drosophila_2:1623968_at:105:291; Interrogation_Position=11560; Antisense; CGGGTGAACTGCGTCCAGGTGCAAT
>probe:Drosophila_2:1623968_at:315:511; Interrogation_Position=11578; Antisense; GTGCAATACCCACACTGCAGCTGAA
>probe:Drosophila_2:1623968_at:481:353; Interrogation_Position=11594; Antisense; GCAGCTGAACCACGACGACACGAAT
>probe:Drosophila_2:1623968_at:263:363; Interrogation_Position=11615; Antisense; GAATATATTCCTCAGCGACTTCGCC
>probe:Drosophila_2:1623968_at:493:401; Interrogation_Position=11688; Antisense; GACATGCTGCTGGTTTAGTCTACCT
>probe:Drosophila_2:1623968_at:293:675; Interrogation_Position=11738; Antisense; TAGCTGTACCATTTTATAGACCTTT
>probe:Drosophila_2:1623968_at:155:5; Interrogation_Position=11773; Antisense; ATTGTACAATGCCACATCACGTCTT
>probe:Drosophila_2:1623968_at:77:151; Interrogation_Position=11786; Antisense; ACATCACGTCTTCTAGTTTTACCAC
>probe:Drosophila_2:1623968_at:247:635; Interrogation_Position=11799; Antisense; TAGTTTTACCACGTAGTCTCTACCG
>probe:Drosophila_2:1623968_at:80:641; Interrogation_Position=11815; Antisense; TCTCTACCGGTGATTTTAATGCGTT
>probe:Drosophila_2:1623968_at:64:685; Interrogation_Position=12013; Antisense; TATCCTGTAATATCCTTGAGCGTAT
>probe:Drosophila_2:1623968_at:73:601; Interrogation_Position=12045; Antisense; TGTAGACTTGTAGATGGCCCAATAT

Paste this into a BLAST search page for me
AAGCACATCTGCTGTCGTCACTTTGGTCACTTTGAGTCGCATTGCTTCCTCGGGTGAACTGCGTCCAGGTGCAATGTGCAATACCCACACTGCAGCTGAAGCAGCTGAACCACGACGACACGAATGAATATATTCCTCAGCGACTTCGCCGACATGCTGCTGGTTTAGTCTACCTTAGCTGTACCATTTTATAGACCTTTATTGTACAATGCCACATCACGTCTTACATCACGTCTTCTAGTTTTACCACTAGTTTTACCACGTAGTCTCTACCGTCTCTACCGGTGATTTTAATGCGTTTATCCTGTAATATCCTTGAGCGTATTGTAGACTTGTAGATGGCCCAATAT

Full Affymetrix probeset data:

Annotations for 1623968_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime