FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623969_at:

>probe:Drosophila_2:1623969_at:694:197; Interrogation_Position=367; Antisense; AACGACAAGGACTTCTGTGTGCCGG
>probe:Drosophila_2:1623969_at:451:427; Interrogation_Position=415; Antisense; GAGATCAAGGTCCATCCGCAAACGG
>probe:Drosophila_2:1623969_at:252:729; Interrogation_Position=463; Antisense; TTGGCCATCCTTCGGCTGGAAAAAC
>probe:Drosophila_2:1623969_at:437:83; Interrogation_Position=494; Antisense; AGTGGACCAACTGGGTTCAGCCGAT
>probe:Drosophila_2:1623969_at:714:451; Interrogation_Position=516; Antisense; GATCTGCTTGGAGGGCACTTCGGAA
>probe:Drosophila_2:1623969_at:709:663; Interrogation_Position=571; Antisense; TACACCGGATTCAACCATATGGCCT
>probe:Drosophila_2:1623969_at:122:529; Interrogation_Position=610; Antisense; GGGTTGGCCATGACAGTATCTACTC
>probe:Drosophila_2:1623969_at:131:617; Interrogation_Position=640; Antisense; TGCAAACAATTGACATCCTCCAGCG
>probe:Drosophila_2:1623969_at:138:119; Interrogation_Position=661; Antisense; AGCGTCCTAGTACCGGTGAACCAGC
>probe:Drosophila_2:1623969_at:385:431; Interrogation_Position=705; Antisense; GAGGACCAAGTTCTATCCGGGAGCA
>probe:Drosophila_2:1623969_at:432:47; Interrogation_Position=719; Antisense; ATCCGGGAGCACCACTGATGGACAT
>probe:Drosophila_2:1623969_at:621:591; Interrogation_Position=782; Antisense; TGGGCATTCTGGTCCGGAACGTAGA
>probe:Drosophila_2:1623969_at:66:73; Interrogation_Position=815; Antisense; AGGCTACCACTCAAGTCTATCAGAA
>probe:Drosophila_2:1623969_at:270:323; Interrogation_Position=848; Antisense; GCGCCCGCTCCTGGATAATGGAAAA

Paste this into a BLAST search page for me
AACGACAAGGACTTCTGTGTGCCGGGAGATCAAGGTCCATCCGCAAACGGTTGGCCATCCTTCGGCTGGAAAAACAGTGGACCAACTGGGTTCAGCCGATGATCTGCTTGGAGGGCACTTCGGAATACACCGGATTCAACCATATGGCCTGGGTTGGCCATGACAGTATCTACTCTGCAAACAATTGACATCCTCCAGCGAGCGTCCTAGTACCGGTGAACCAGCGAGGACCAAGTTCTATCCGGGAGCAATCCGGGAGCACCACTGATGGACATTGGGCATTCTGGTCCGGAACGTAGAAGGCTACCACTCAAGTCTATCAGAAGCGCCCGCTCCTGGATAATGGAAAA

Full Affymetrix probeset data:

Annotations for 1623969_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720