FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623971_at:

>probe:Drosophila_2:1623971_at:666:553; Interrogation_Position=168; Antisense; GGAGCTGCAGGCGAACTTCATACCG
>probe:Drosophila_2:1623971_at:231:323; Interrogation_Position=195; Antisense; GCGCTGCGACGTCTCCAAGGAAGAT
>probe:Drosophila_2:1623971_at:221:103; Interrogation_Position=227; Antisense; AGAGCTCTTTTGACTGGATCGAACG
>probe:Drosophila_2:1623971_at:520:233; Interrogation_Position=283; Antisense; AATGCTGGCATTACTCGCGAGACGG
>probe:Drosophila_2:1623971_at:415:371; Interrogation_Position=421; Antisense; GAAGGTCACGTTCTCATCATCAACA
>probe:Drosophila_2:1623971_at:668:401; Interrogation_Position=455; Antisense; GACATCAGGTGCTCAACTTCATCGA
>probe:Drosophila_2:1623971_at:577:647; Interrogation_Position=473; Antisense; TCATCGACGTTTTGCCATCGTTCAA
>probe:Drosophila_2:1623971_at:48:475; Interrogation_Position=492; Antisense; GTTCAATATATATCCGGCCACCAAG
>probe:Drosophila_2:1623971_at:710:563; Interrogation_Position=552; Antisense; GGAATTTCAGCTGCACTCGAACAAA
>probe:Drosophila_2:1623971_at:108:185; Interrogation_Position=574; Antisense; AAAATCCGGGTTACTGGCATCTGTC
>probe:Drosophila_2:1623971_at:458:569; Interrogation_Position=589; Antisense; GGCATCTGTCCTGGTGCGGTGAACA
>probe:Drosophila_2:1623971_at:35:613; Interrogation_Position=608; Antisense; TGAACACGAACATCTTCCCGGAAGA
>probe:Drosophila_2:1623971_at:435:85; Interrogation_Position=690; Antisense; AGTGATGTATGCTCTGCGAACTCCG
>probe:Drosophila_2:1623971_at:555:383; Interrogation_Position=707; Antisense; GAACTCCGCCTCATGTTCAGGTGAG

Paste this into a BLAST search page for me
GGAGCTGCAGGCGAACTTCATACCGGCGCTGCGACGTCTCCAAGGAAGATAGAGCTCTTTTGACTGGATCGAACGAATGCTGGCATTACTCGCGAGACGGGAAGGTCACGTTCTCATCATCAACAGACATCAGGTGCTCAACTTCATCGATCATCGACGTTTTGCCATCGTTCAAGTTCAATATATATCCGGCCACCAAGGGAATTTCAGCTGCACTCGAACAAAAAAATCCGGGTTACTGGCATCTGTCGGCATCTGTCCTGGTGCGGTGAACATGAACACGAACATCTTCCCGGAAGAAGTGATGTATGCTCTGCGAACTCCGGAACTCCGCCTCATGTTCAGGTGAG

Full Affymetrix probeset data:

Annotations for 1623971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720