FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623974_at:

>probe:Drosophila_2:1623974_at:75:483; Interrogation_Position=1048; Antisense; GTATATTTTGTCACAGCTTCTTTCT
>probe:Drosophila_2:1623974_at:88:373; Interrogation_Position=526; Antisense; GAAGTGCCGAGGGATTTACCATAAT
>probe:Drosophila_2:1623974_at:67:151; Interrogation_Position=558; Antisense; ACATTAGCGGCAGCTTTGCTCTGGA
>probe:Drosophila_2:1623974_at:545:11; Interrogation_Position=588; Antisense; ATTCAATTCTTTGGGTATCTCCGGC
>probe:Drosophila_2:1623974_at:551:661; Interrogation_Position=623; Antisense; TAAATTACGATTCGCCACCTCGGAA
>probe:Drosophila_2:1623974_at:201:677; Interrogation_Position=673; Antisense; TAGGAAATACTTGCGGCCGAGCCTC
>probe:Drosophila_2:1623974_at:205:317; Interrogation_Position=693; Antisense; GCCTCGGGCTCACATTTGCTGAAAG
>probe:Drosophila_2:1623974_at:119:69; Interrogation_Position=731; Antisense; ATGGCTCTCACATGCGAGATGCTTT
>probe:Drosophila_2:1623974_at:343:99; Interrogation_Position=747; Antisense; AGATGCTTTGTGGATACATGCCCTC
>probe:Drosophila_2:1623974_at:634:265; Interrogation_Position=817; Antisense; CAGATGGCTGTGGAGTCGAGTCAAA
>probe:Drosophila_2:1623974_at:426:221; Interrogation_Position=840; Antisense; AAGGTGCAATAACCCAACCGAGCGG
>probe:Drosophila_2:1623974_at:239:29; Interrogation_Position=873; Antisense; AAACTAAATGGCTGCGGGTTGCGTT
>probe:Drosophila_2:1623974_at:318:337; Interrogation_Position=953; Antisense; GCTCCTCTGCGGATTCAGTAGCTAT
>probe:Drosophila_2:1623974_at:330:223; Interrogation_Position=999; Antisense; AAGGGTACACCCGAGGGCACTCAGA

Paste this into a BLAST search page for me
GTATATTTTGTCACAGCTTCTTTCTGAAGTGCCGAGGGATTTACCATAATACATTAGCGGCAGCTTTGCTCTGGAATTCAATTCTTTGGGTATCTCCGGCTAAATTACGATTCGCCACCTCGGAATAGGAAATACTTGCGGCCGAGCCTCGCCTCGGGCTCACATTTGCTGAAAGATGGCTCTCACATGCGAGATGCTTTAGATGCTTTGTGGATACATGCCCTCCAGATGGCTGTGGAGTCGAGTCAAAAAGGTGCAATAACCCAACCGAGCGGAAACTAAATGGCTGCGGGTTGCGTTGCTCCTCTGCGGATTCAGTAGCTATAAGGGTACACCCGAGGGCACTCAGA

Full Affymetrix probeset data:

Annotations for 1623974_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720