Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623975_at:

>probe:Drosophila_2:1623975_at:168:205; Interrogation_Position=1428; Antisense; AAGCCATTTGTCTGCGAGTTCTGCG
>probe:Drosophila_2:1623975_at:391:139; Interrogation_Position=1489; Antisense; ACGTAACTGCGGTTCACACCAAGAT
>probe:Drosophila_2:1623975_at:369:215; Interrogation_Position=1509; Antisense; AAGATCCGAGCCTTCAAGTGCGACA
>probe:Drosophila_2:1623975_at:163:219; Interrogation_Position=1524; Antisense; AAGTGCGACATGTGCCCCAAGGACT
>probe:Drosophila_2:1623975_at:364:225; Interrogation_Position=1569; Antisense; AAGGACCACGTAAAGGCGCACCTGA
>probe:Drosophila_2:1623975_at:173:73; Interrogation_Position=1615; Antisense; AGGTCTGTCAGAAGGCCTTCACCAA
>probe:Drosophila_2:1623975_at:274:49; Interrogation_Position=1639; Antisense; ATGCCAACGCCTTAGTCAAGCATCG
>probe:Drosophila_2:1623975_at:525:109; Interrogation_Position=1678; Antisense; AGAAGACCCTGCAATGTTCGCTCTG
>probe:Drosophila_2:1623975_at:28:137; Interrogation_Position=1704; Antisense; ACGACGCGCTTCTCGGAGCGAGTTA
>probe:Drosophila_2:1623975_at:370:415; Interrogation_Position=1719; Antisense; GAGCGAGTTAGTCTTGGCGTCCACA
>probe:Drosophila_2:1623975_at:498:653; Interrogation_Position=1765; Antisense; TCAAGAGCTCTCTGTCGTCAAGCGA
>probe:Drosophila_2:1623975_at:272:495; Interrogation_Position=1781; Antisense; GTCAAGCGACGCACTCTTTACAAAG
>probe:Drosophila_2:1623975_at:615:697; Interrogation_Position=1797; Antisense; TTTACAAAGACATTCCCTCAGCCTT
>probe:Drosophila_2:1623975_at:177:281; Interrogation_Position=1813; Antisense; CTCAGCCTTGAGACATTTCCAAACC

Paste this into a BLAST search page for me
AAGCCATTTGTCTGCGAGTTCTGCGACGTAACTGCGGTTCACACCAAGATAAGATCCGAGCCTTCAAGTGCGACAAAGTGCGACATGTGCCCCAAGGACTAAGGACCACGTAAAGGCGCACCTGAAGGTCTGTCAGAAGGCCTTCACCAAATGCCAACGCCTTAGTCAAGCATCGAGAAGACCCTGCAATGTTCGCTCTGACGACGCGCTTCTCGGAGCGAGTTAGAGCGAGTTAGTCTTGGCGTCCACATCAAGAGCTCTCTGTCGTCAAGCGAGTCAAGCGACGCACTCTTTACAAAGTTTACAAAGACATTCCCTCAGCCTTCTCAGCCTTGAGACATTTCCAAACC

Full Affymetrix probeset data:

Annotations for 1623975_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime