Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623976_at:

>probe:Drosophila_2:1623976_at:551:623; Interrogation_Position=1313; Antisense; TGCGCCATGTTGAACCTCGATTAGT
>probe:Drosophila_2:1623976_at:605:171; Interrogation_Position=1342; Antisense; AAAGTATCTCGGCTTTTGGTGCCTG
>probe:Drosophila_2:1623976_at:199:235; Interrogation_Position=1369; Antisense; AATGCCAGTGAACAGGTGTCCGCTT
>probe:Drosophila_2:1623976_at:462:513; Interrogation_Position=1384; Antisense; GTGTCCGCTTTGCTGAGTTTTAATC
>probe:Drosophila_2:1623976_at:121:459; Interrogation_Position=1482; Antisense; GATTTTTCGCTTTTCATCTGCTTGC
>probe:Drosophila_2:1623976_at:330:343; Interrogation_Position=1505; Antisense; GCTTGGGATCTCCACATATTGGCTA
>probe:Drosophila_2:1623976_at:641:233; Interrogation_Position=1533; Antisense; AATGCGCGTTGACAGCCACTTGGAG
>probe:Drosophila_2:1623976_at:219:365; Interrogation_Position=1605; Antisense; GAATCACTGGGTAGTTTCCGACTTT
>probe:Drosophila_2:1623976_at:462:479; Interrogation_Position=1618; Antisense; GTTTCCGACTTTAACGATGCCATGC
>probe:Drosophila_2:1623976_at:616:445; Interrogation_Position=1633; Antisense; GATGCCATGCGTGCTGGATACGTTA
>probe:Drosophila_2:1623976_at:236:197; Interrogation_Position=1669; Antisense; AACGTCCTGGGCTATCAAAGTATCG
>probe:Drosophila_2:1623976_at:44:249; Interrogation_Position=1731; Antisense; AATTGGTTGGATACTGTCAGCTCTG
>probe:Drosophila_2:1623976_at:13:651; Interrogation_Position=1747; Antisense; TCAGCTCTGGTTTTCTCTTGTGAAT
>probe:Drosophila_2:1623976_at:673:567; Interrogation_Position=1775; Antisense; GGCACCTTTATCCATGGCGATTTAT

Paste this into a BLAST search page for me
TGCGCCATGTTGAACCTCGATTAGTAAAGTATCTCGGCTTTTGGTGCCTGAATGCCAGTGAACAGGTGTCCGCTTGTGTCCGCTTTGCTGAGTTTTAATCGATTTTTCGCTTTTCATCTGCTTGCGCTTGGGATCTCCACATATTGGCTAAATGCGCGTTGACAGCCACTTGGAGGAATCACTGGGTAGTTTCCGACTTTGTTTCCGACTTTAACGATGCCATGCGATGCCATGCGTGCTGGATACGTTAAACGTCCTGGGCTATCAAAGTATCGAATTGGTTGGATACTGTCAGCTCTGTCAGCTCTGGTTTTCTCTTGTGAATGGCACCTTTATCCATGGCGATTTAT

Full Affymetrix probeset data:

Annotations for 1623976_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime