Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623977_at:

>probe:Drosophila_2:1623977_at:319:153; Interrogation_Position=2849; Antisense; ACAGATTGACGTGCATTTTCACTAA
>probe:Drosophila_2:1623977_at:108:251; Interrogation_Position=2887; Antisense; CAATGTTTCAAGATGTCCATGGTAT
>probe:Drosophila_2:1623977_at:181:505; Interrogation_Position=2901; Antisense; GTCCATGGTATTGAGCGGGTTGAAT
>probe:Drosophila_2:1623977_at:391:243; Interrogation_Position=2956; Antisense; AATATTAATTACTCTCACTCACAAA
>probe:Drosophila_2:1623977_at:229:245; Interrogation_Position=2992; Antisense; AATTTATCCAGCAATTCTCAACCTG
>probe:Drosophila_2:1623977_at:293:363; Interrogation_Position=3002; Antisense; GCAATTCTCAACCTGTGACTTAATG
>probe:Drosophila_2:1623977_at:407:395; Interrogation_Position=3030; Antisense; GAAATCGCATTTTTACCATCAGCAC
>probe:Drosophila_2:1623977_at:244:307; Interrogation_Position=3045; Antisense; CCATCAGCACTTTCACACTCGAAAT
>probe:Drosophila_2:1623977_at:21:209; Interrogation_Position=3153; Antisense; AAGCAGTCAAATTCTGTGAGTAAGC
>probe:Drosophila_2:1623977_at:195:513; Interrogation_Position=3168; Antisense; GTGAGTAAGCAACCCAAAGCGAGTA
>probe:Drosophila_2:1623977_at:728:137; Interrogation_Position=3245; Antisense; ACGGATATGATTACGATTATGGCTA
>probe:Drosophila_2:1623977_at:628:675; Interrogation_Position=3298; Antisense; TAGTATTTATTGTACTCCCTAAACT
>probe:Drosophila_2:1623977_at:416:489; Interrogation_Position=3364; Antisense; TGTTAAACCCACAAACGCGGGCTGC
>probe:Drosophila_2:1623977_at:713:335; Interrogation_Position=3384; Antisense; GCTGCTGCAAGGCTCCGGCAAAAGA

Paste this into a BLAST search page for me
ACAGATTGACGTGCATTTTCACTAACAATGTTTCAAGATGTCCATGGTATGTCCATGGTATTGAGCGGGTTGAATAATATTAATTACTCTCACTCACAAAAATTTATCCAGCAATTCTCAACCTGGCAATTCTCAACCTGTGACTTAATGGAAATCGCATTTTTACCATCAGCACCCATCAGCACTTTCACACTCGAAATAAGCAGTCAAATTCTGTGAGTAAGCGTGAGTAAGCAACCCAAAGCGAGTAACGGATATGATTACGATTATGGCTATAGTATTTATTGTACTCCCTAAACTTGTTAAACCCACAAACGCGGGCTGCGCTGCTGCAAGGCTCCGGCAAAAGA

Full Affymetrix probeset data:

Annotations for 1623977_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime