FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623978_at:

>probe:Drosophila_2:1623978_at:398:229; Interrogation_Position=1027; Antisense; AATGTCATTGCTGGCAGACCCGAAT
>probe:Drosophila_2:1623978_at:396:435; Interrogation_Position=1067; Antisense; GAGGTATCCGTAGCAGATGTTTTCA
>probe:Drosophila_2:1623978_at:575:473; Interrogation_Position=561; Antisense; GTTCACAGATGCACCTAACCAGAGG
>probe:Drosophila_2:1623978_at:358:359; Interrogation_Position=648; Antisense; GCAACTCTCTGGTGCTAAGACTTTT
>probe:Drosophila_2:1623978_at:448:695; Interrogation_Position=671; Antisense; TTTCGCATCGAATCCGGAATACCCA
>probe:Drosophila_2:1623978_at:667:147; Interrogation_Position=719; Antisense; ACTAGGCTCCGTCGAGAGATCTCAG
>probe:Drosophila_2:1623978_at:544:427; Interrogation_Position=734; Antisense; GAGATCTCAGAGTTCTCAACCGATC
>probe:Drosophila_2:1623978_at:3:323; Interrogation_Position=789; Antisense; GCGACAATCTGTTCCACTGGGTAGC
>probe:Drosophila_2:1623978_at:595:519; Interrogation_Position=863; Antisense; GTGGAGATAGTCTTTCCCAGGAACT
>probe:Drosophila_2:1623978_at:715:659; Interrogation_Position=918; Antisense; TAACCAAGACTTACCACTGCAACAT
>probe:Drosophila_2:1623978_at:476:359; Interrogation_Position=936; Antisense; GCAACATCGCTTTATCTGGGCGCAT
>probe:Drosophila_2:1623978_at:563:575; Interrogation_Position=954; Antisense; GGCGCATTTGCCTGGATATTCTCGG
>probe:Drosophila_2:1623978_at:457:459; Interrogation_Position=968; Antisense; GATATTCTCGGCTCGAAGTGGTCGC
>probe:Drosophila_2:1623978_at:657:263; Interrogation_Position=993; Antisense; CAGCTTTGTCGGTTTCCAAGGTACT

Paste this into a BLAST search page for me
AATGTCATTGCTGGCAGACCCGAATGAGGTATCCGTAGCAGATGTTTTCAGTTCACAGATGCACCTAACCAGAGGGCAACTCTCTGGTGCTAAGACTTTTTTTCGCATCGAATCCGGAATACCCAACTAGGCTCCGTCGAGAGATCTCAGGAGATCTCAGAGTTCTCAACCGATCGCGACAATCTGTTCCACTGGGTAGCGTGGAGATAGTCTTTCCCAGGAACTTAACCAAGACTTACCACTGCAACATGCAACATCGCTTTATCTGGGCGCATGGCGCATTTGCCTGGATATTCTCGGGATATTCTCGGCTCGAAGTGGTCGCCAGCTTTGTCGGTTTCCAAGGTACT

Full Affymetrix probeset data:

Annotations for 1623978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720