Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623979_at:

>probe:Drosophila_2:1623979_at:276:169; Interrogation_Position=467; Antisense; AAATGGGCAAGCGAGTGTCACTAAC
>probe:Drosophila_2:1623979_at:330:171; Interrogation_Position=512; Antisense; AAAGAGATGTCAACACCCTGCTGGG
>probe:Drosophila_2:1623979_at:18:537; Interrogation_Position=537; Antisense; GGTCTATGGCTATCGGCGCACTGGC
>probe:Drosophila_2:1623979_at:659:355; Interrogation_Position=554; Antisense; GCACTGGCCTTAATCCTCTGAAATG
>probe:Drosophila_2:1623979_at:464:389; Interrogation_Position=584; Antisense; GAAACACCCATCTGCCAGTGGAGTA
>probe:Drosophila_2:1623979_at:140:117; Interrogation_Position=623; Antisense; AGCATAGCGCCCTTATGATCTTCGC
>probe:Drosophila_2:1623979_at:415:129; Interrogation_Position=655; Antisense; ACCATGCACTCGGTGCTGTGGGAAA
>probe:Drosophila_2:1623979_at:444:513; Interrogation_Position=686; Antisense; GTGTCAAACACGAAGTCCTGGCCAT
>probe:Drosophila_2:1623979_at:649:627; Interrogation_Position=776; Antisense; TGCCACGTTACTACACCAGACAGAT
>probe:Drosophila_2:1623979_at:569:453; Interrogation_Position=798; Antisense; GATAAAAGCTCGTCCAATGCTGCCA
>probe:Drosophila_2:1623979_at:188:637; Interrogation_Position=826; Antisense; TCGTCGAACCAATCCTGCAGTGAGT
>probe:Drosophila_2:1623979_at:573:359; Interrogation_Position=866; Antisense; GCAACGTGATCCTCATCAGCTTGAA
>probe:Drosophila_2:1623979_at:194:609; Interrogation_Position=891; Antisense; TGACCTCCGGCCACTAATGGATTTA
>probe:Drosophila_2:1623979_at:623:691; Interrogation_Position=920; Antisense; TTTGGCAGCAATCGCTAACCGTCGA

Paste this into a BLAST search page for me
AAATGGGCAAGCGAGTGTCACTAACAAAGAGATGTCAACACCCTGCTGGGGGTCTATGGCTATCGGCGCACTGGCGCACTGGCCTTAATCCTCTGAAATGGAAACACCCATCTGCCAGTGGAGTAAGCATAGCGCCCTTATGATCTTCGCACCATGCACTCGGTGCTGTGGGAAAGTGTCAAACACGAAGTCCTGGCCATTGCCACGTTACTACACCAGACAGATGATAAAAGCTCGTCCAATGCTGCCATCGTCGAACCAATCCTGCAGTGAGTGCAACGTGATCCTCATCAGCTTGAATGACCTCCGGCCACTAATGGATTTATTTGGCAGCAATCGCTAACCGTCGA

Full Affymetrix probeset data:

Annotations for 1623979_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime