FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623980_at:

>probe:Drosophila_2:1623980_at:369:567; Interrogation_Position=142; Antisense; GGCAGATTCAACATCCACGTTAGCA
>probe:Drosophila_2:1623980_at:619:409; Interrogation_Position=261; Antisense; GACCGTCAAACCGATCAAGCTAACT
>probe:Drosophila_2:1623980_at:382:555; Interrogation_Position=290; Antisense; GGACCAGTAGCACCACAACAACGAG
>probe:Drosophila_2:1623980_at:721:141; Interrogation_Position=343; Antisense; ACTGTATCTACAGTGGCTCCTACTA
>probe:Drosophila_2:1623980_at:300:665; Interrogation_Position=395; Antisense; TAAATCTGTTGGCTGACATTGCGGC
>probe:Drosophila_2:1623980_at:491:29; Interrogation_Position=427; Antisense; ATAACGAAGCCCAAGTCCAGACTAA
>probe:Drosophila_2:1623980_at:611:193; Interrogation_Position=477; Antisense; AATCGGCGGTCTAACGAAGCCCTTG
>probe:Drosophila_2:1623980_at:712:21; Interrogation_Position=530; Antisense; ATATACCCAGTATGGCTGCAGCGGC
>probe:Drosophila_2:1623980_at:284:121; Interrogation_Position=549; Antisense; AGCGGCACCAACTGCTTTAATTACG
>probe:Drosophila_2:1623980_at:451:423; Interrogation_Position=589; Antisense; GAGAACATTGAGTACACGCCGCCCA
>probe:Drosophila_2:1623980_at:93:255; Interrogation_Position=621; Antisense; CAACTCGCCCATTTTCAAGGTGAAA
>probe:Drosophila_2:1623980_at:73:165; Interrogation_Position=643; Antisense; AAAGTTCAACGATCTTCGGTGCCGG
>probe:Drosophila_2:1623980_at:22:37; Interrogation_Position=698; Antisense; ATCAGGTGCGAGATGCCCAGGGCAA
>probe:Drosophila_2:1623980_at:228:83; Interrogation_Position=716; Antisense; AGGGCAAGTGCACCGACTCGATCTA

Paste this into a BLAST search page for me
GGCAGATTCAACATCCACGTTAGCAGACCGTCAAACCGATCAAGCTAACTGGACCAGTAGCACCACAACAACGAGACTGTATCTACAGTGGCTCCTACTATAAATCTGTTGGCTGACATTGCGGCATAACGAAGCCCAAGTCCAGACTAAAATCGGCGGTCTAACGAAGCCCTTGATATACCCAGTATGGCTGCAGCGGCAGCGGCACCAACTGCTTTAATTACGGAGAACATTGAGTACACGCCGCCCACAACTCGCCCATTTTCAAGGTGAAAAAAGTTCAACGATCTTCGGTGCCGGATCAGGTGCGAGATGCCCAGGGCAAAGGGCAAGTGCACCGACTCGATCTA

Full Affymetrix probeset data:

Annotations for 1623980_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720