Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623981_at:

>probe:Drosophila_2:1623981_at:551:125; Interrogation_Position=1013; Antisense; ACCAACATCACCTACGTAAACGTCG
>probe:Drosophila_2:1623981_at:671:463; Interrogation_Position=1043; Antisense; GATTGCCAGAGCTATGGACGTTGCT
>probe:Drosophila_2:1623981_at:411:81; Interrogation_Position=1131; Antisense; AGGGATGCACACAGACCAACTACCA
>probe:Drosophila_2:1623981_at:703:189; Interrogation_Position=1157; Antisense; AACATCGCATGTTCCGTGTAGGCTG
>probe:Drosophila_2:1623981_at:408:715; Interrogation_Position=1168; Antisense; TTCCGTGTAGGCTGTCCCAGAAGAT
>probe:Drosophila_2:1623981_at:504:109; Interrogation_Position=1186; Antisense; AGAAGATCGCATCCTTACCACAATC
>probe:Drosophila_2:1623981_at:285:233; Interrogation_Position=1207; Antisense; AATCCTTACCAAATCGCATCCAATT
>probe:Drosophila_2:1623981_at:625:401; Interrogation_Position=1328; Antisense; GACATTCATCCATTTACTTTTTACC
>probe:Drosophila_2:1623981_at:375:51; Interrogation_Position=1400; Antisense; ATGTGTTACTCCATTGAAACCTGAA
>probe:Drosophila_2:1623981_at:665:145; Interrogation_Position=864; Antisense; ACTACTATATCTGTGGCAGCCCCGT
>probe:Drosophila_2:1623981_at:56:131; Interrogation_Position=918; Antisense; ACCTGAGCTGTCCACTTGGCCAGTA
>probe:Drosophila_2:1623981_at:611:729; Interrogation_Position=933; Antisense; TTGGCCAGTACTTCGACTTCGAGAA
>probe:Drosophila_2:1623981_at:255:423; Interrogation_Position=953; Antisense; GAGAAGCTCTCGTGCCGCGACAGAC
>probe:Drosophila_2:1623981_at:386:105; Interrogation_Position=974; Antisense; AGACTTAACGTACGCTGCCAGCTGG

Paste this into a BLAST search page for me
ACCAACATCACCTACGTAAACGTCGGATTGCCAGAGCTATGGACGTTGCTAGGGATGCACACAGACCAACTACCAAACATCGCATGTTCCGTGTAGGCTGTTCCGTGTAGGCTGTCCCAGAAGATAGAAGATCGCATCCTTACCACAATCAATCCTTACCAAATCGCATCCAATTGACATTCATCCATTTACTTTTTACCATGTGTTACTCCATTGAAACCTGAAACTACTATATCTGTGGCAGCCCCGTACCTGAGCTGTCCACTTGGCCAGTATTGGCCAGTACTTCGACTTCGAGAAGAGAAGCTCTCGTGCCGCGACAGACAGACTTAACGTACGCTGCCAGCTGG

Full Affymetrix probeset data:

Annotations for 1623981_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime