FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623983_at:

>probe:Drosophila_2:1623983_at:548:177; Interrogation_Position=2518; Antisense; AAACTCCACGGAAGCAGACACAGAA
>probe:Drosophila_2:1623983_at:668:557; Interrogation_Position=2563; Antisense; GGACATTGGAACATCACCTGTACAT
>probe:Drosophila_2:1623983_at:560:33; Interrogation_Position=2586; Antisense; ATCAATGGCCACTGCCAAGGTCGTA
>probe:Drosophila_2:1623983_at:665:311; Interrogation_Position=2599; Antisense; GCCAAGGTCGTAGCCATTGCAAGTT
>probe:Drosophila_2:1623983_at:244:541; Interrogation_Position=2673; Antisense; GGTTGTTTTTGGTTCATCAGTTGGA
>probe:Drosophila_2:1623983_at:603:13; Interrogation_Position=2744; Antisense; ATTAAGCTCAACTTGCTCTTCTCAT
>probe:Drosophila_2:1623983_at:42:621; Interrogation_Position=2775; Antisense; TGCTATTCGCACTCTAGCCAAACGA
>probe:Drosophila_2:1623983_at:619:699; Interrogation_Position=2817; Antisense; TTTTTCGCGAGAAAGCCGCCCCTAT
>probe:Drosophila_2:1623983_at:453:451; Interrogation_Position=2855; Antisense; GATCGTAGTCATTTAAGCGCTTCAT
>probe:Drosophila_2:1623983_at:627:123; Interrogation_Position=2870; Antisense; AGCGCTTCATGTAAATATCGAGTCA
>probe:Drosophila_2:1623983_at:25:665; Interrogation_Position=2923; Antisense; TAAATATGCATCGTCGCCTGTTGTG
>probe:Drosophila_2:1623983_at:57:301; Interrogation_Position=2937; Antisense; CGCCTGTTGTGTGTGTCTAATCGAA
>probe:Drosophila_2:1623983_at:384:703; Interrogation_Position=2984; Antisense; TTATTGTTAATTTGACGCCGCGTAC
>probe:Drosophila_2:1623983_at:269:319; Interrogation_Position=3000; Antisense; GCCGCGTACACTTGGAGTACCTCAA

Paste this into a BLAST search page for me
AAACTCCACGGAAGCAGACACAGAAGGACATTGGAACATCACCTGTACATATCAATGGCCACTGCCAAGGTCGTAGCCAAGGTCGTAGCCATTGCAAGTTGGTTGTTTTTGGTTCATCAGTTGGAATTAAGCTCAACTTGCTCTTCTCATTGCTATTCGCACTCTAGCCAAACGATTTTTCGCGAGAAAGCCGCCCCTATGATCGTAGTCATTTAAGCGCTTCATAGCGCTTCATGTAAATATCGAGTCATAAATATGCATCGTCGCCTGTTGTGCGCCTGTTGTGTGTGTCTAATCGAATTATTGTTAATTTGACGCCGCGTACGCCGCGTACACTTGGAGTACCTCAA

Full Affymetrix probeset data:

Annotations for 1623983_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720