Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623985_at:

>probe:Drosophila_2:1623985_at:339:445; Interrogation_Position=1072; Antisense; GATGACCACATGAAGGATCTCTCCC
>probe:Drosophila_2:1623985_at:317:633; Interrogation_Position=1093; Antisense; TCCCCATCGCCAATTTCAAAATGTC
>probe:Drosophila_2:1623985_at:389:175; Interrogation_Position=1123; Antisense; AAACGGAAAGCATCGAACAACCATT
>probe:Drosophila_2:1623985_at:404:237; Interrogation_Position=1140; Antisense; CAACCATTCGGACAGACTCCTTGAA
>probe:Drosophila_2:1623985_at:298:389; Interrogation_Position=1174; Antisense; GAAAAACTGGCGATCGAGCGAGAAA
>probe:Drosophila_2:1623985_at:167:683; Interrogation_Position=1209; Antisense; TATGAAGGATGCACTGCTGGAGCTA
>probe:Drosophila_2:1623985_at:39:333; Interrogation_Position=1224; Antisense; GCTGGAGCTAAACGCATTTCACAAA
>probe:Drosophila_2:1623985_at:567:675; Interrogation_Position=1313; Antisense; TAGCGTGGTGTTACTTTTTCAGCAA
>probe:Drosophila_2:1623985_at:175:231; Interrogation_Position=1365; Antisense; AATGTAATATTGCTTCAACTTCAAA
>probe:Drosophila_2:1623985_at:579:459; Interrogation_Position=1427; Antisense; GATTTTGCATTGTTATGATCTTACA
>probe:Drosophila_2:1623985_at:721:415; Interrogation_Position=901; Antisense; GAGCCTGAGGAATTGTCTTCATTAA
>probe:Drosophila_2:1623985_at:616:273; Interrogation_Position=920; Antisense; CATTAAAAGACGAGCCTATGGCCGG
>probe:Drosophila_2:1623985_at:78:455; Interrogation_Position=970; Antisense; GATATGGTTGCTAGCAAAGCCATGA
>probe:Drosophila_2:1623985_at:76:309; Interrogation_Position=988; Antisense; GCCATGAAAAGAACGCGAACTCCCT

Paste this into a BLAST search page for me
GATGACCACATGAAGGATCTCTCCCTCCCCATCGCCAATTTCAAAATGTCAAACGGAAAGCATCGAACAACCATTCAACCATTCGGACAGACTCCTTGAAGAAAAACTGGCGATCGAGCGAGAAATATGAAGGATGCACTGCTGGAGCTAGCTGGAGCTAAACGCATTTCACAAATAGCGTGGTGTTACTTTTTCAGCAAAATGTAATATTGCTTCAACTTCAAAGATTTTGCATTGTTATGATCTTACAGAGCCTGAGGAATTGTCTTCATTAACATTAAAAGACGAGCCTATGGCCGGGATATGGTTGCTAGCAAAGCCATGAGCCATGAAAAGAACGCGAACTCCCT

Full Affymetrix probeset data:

Annotations for 1623985_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime