FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623986_at:

>probe:Drosophila_2:1623986_at:248:131; Interrogation_Position=1014; Antisense; ACTTATACGATTGCAGGACCCACTG
>probe:Drosophila_2:1623986_at:432:569; Interrogation_Position=1045; Antisense; GGCAGTCAGACCTCCGCGAATGTGA
>probe:Drosophila_2:1623986_at:246:63; Interrogation_Position=1064; Antisense; ATGTGAGCGTGGCTCCCATTTGCAC
>probe:Drosophila_2:1623986_at:690:19; Interrogation_Position=1081; Antisense; ATTTGCACCCAGTTCGAGCTGACCA
>probe:Drosophila_2:1623986_at:242:511; Interrogation_Position=1151; Antisense; GTGAAGACACTGACTGTCCGCTGTT
>probe:Drosophila_2:1623986_at:504:471; Interrogation_Position=1173; Antisense; GTTCGAGATGCCCATGCGACTGCGT
>probe:Drosophila_2:1623986_at:258:545; Interrogation_Position=1215; Antisense; GGATCTACCCAATTACGGCGGAGTT
>probe:Drosophila_2:1623986_at:27:527; Interrogation_Position=1248; Antisense; GGGCAGCTCACATCTTTGCGTGGAG
>probe:Drosophila_2:1623986_at:170:569; Interrogation_Position=1345; Antisense; GGCAGTGTACTCCATCTGGTGCGAC
>probe:Drosophila_2:1623986_at:386:621; Interrogation_Position=1420; Antisense; TGCGAGGCACGGACCATGTACTTCA
>probe:Drosophila_2:1623986_at:369:601; Interrogation_Position=1436; Antisense; TGTACTTCACGGGTCTGCTGAGTCC
>probe:Drosophila_2:1623986_at:422:415; Interrogation_Position=908; Antisense; GACCAAGTCATGCTGTTTTCGGAGT
>probe:Drosophila_2:1623986_at:151:303; Interrogation_Position=956; Antisense; CCGACGAGGACTATCTGGCGGATAT
>probe:Drosophila_2:1623986_at:140:87; Interrogation_Position=981; Antisense; AGTGCGCCTGGTTCAATTTCAAAAG

Paste this into a BLAST search page for me
ACTTATACGATTGCAGGACCCACTGGGCAGTCAGACCTCCGCGAATGTGAATGTGAGCGTGGCTCCCATTTGCACATTTGCACCCAGTTCGAGCTGACCAGTGAAGACACTGACTGTCCGCTGTTGTTCGAGATGCCCATGCGACTGCGTGGATCTACCCAATTACGGCGGAGTTGGGCAGCTCACATCTTTGCGTGGAGGGCAGTGTACTCCATCTGGTGCGACTGCGAGGCACGGACCATGTACTTCATGTACTTCACGGGTCTGCTGAGTCCGACCAAGTCATGCTGTTTTCGGAGTCCGACGAGGACTATCTGGCGGATATAGTGCGCCTGGTTCAATTTCAAAAG

Full Affymetrix probeset data:

Annotations for 1623986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720