FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623987_at:

>probe:Drosophila_2:1623987_at:198:453; Interrogation_Position=178; Antisense; GATCTTGGCCTGCATTTACACGATG
>probe:Drosophila_2:1623987_at:187:623; Interrogation_Position=311; Antisense; TGCGGACGCACCTTTATGATCTCAG
>probe:Drosophila_2:1623987_at:576:35; Interrogation_Position=338; Antisense; ATCATACTGGAGGTTATCCCGCTGC
>probe:Drosophila_2:1623987_at:116:189; Interrogation_Position=371; Antisense; AACATCGAGTTCTACCTGGTATCCG
>probe:Drosophila_2:1623987_at:535:467; Interrogation_Position=430; Antisense; GTTGATTCCACTGTTCTACGACATG
>probe:Drosophila_2:1623987_at:274:35; Interrogation_Position=464; Antisense; ATCAGCGAGGACTGGGACAGCTCCA
>probe:Drosophila_2:1623987_at:296:607; Interrogation_Position=498; Antisense; TGATGGACCTCGCTCTGTTGGGCAA
>probe:Drosophila_2:1623987_at:154:629; Interrogation_Position=530; Antisense; TCCACGTTGTATCTGGCCATCAAGG
>probe:Drosophila_2:1623987_at:529:71; Interrogation_Position=552; Antisense; AGGACGGCAACCATATCTACTTCGG
>probe:Drosophila_2:1623987_at:401:23; Interrogation_Position=564; Antisense; ATATCTACTTCGGTGTGGCTGCCAC
>probe:Drosophila_2:1623987_at:233:95; Interrogation_Position=602; Antisense; AGATACGGCGGTGCAATTGTCGATA
>probe:Drosophila_2:1623987_at:467:501; Interrogation_Position=620; Antisense; GTCGATAGCTGCAACGAGGGCCTTA
>probe:Drosophila_2:1623987_at:260:677; Interrogation_Position=654; Antisense; TAGAGACTCTGGGAAACACCGGCAT
>probe:Drosophila_2:1623987_at:419:705; Interrogation_Position=687; Antisense; TTATGACCTACGCACTCACTGAGGG

Paste this into a BLAST search page for me
GATCTTGGCCTGCATTTACACGATGTGCGGACGCACCTTTATGATCTCAGATCATACTGGAGGTTATCCCGCTGCAACATCGAGTTCTACCTGGTATCCGGTTGATTCCACTGTTCTACGACATGATCAGCGAGGACTGGGACAGCTCCATGATGGACCTCGCTCTGTTGGGCAATCCACGTTGTATCTGGCCATCAAGGAGGACGGCAACCATATCTACTTCGGATATCTACTTCGGTGTGGCTGCCACAGATACGGCGGTGCAATTGTCGATAGTCGATAGCTGCAACGAGGGCCTTATAGAGACTCTGGGAAACACCGGCATTTATGACCTACGCACTCACTGAGGG

Full Affymetrix probeset data:

Annotations for 1623987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720