FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623988_at:

>probe:Drosophila_2:1623988_at:264:299; Interrogation_Position=1188; Antisense; CGCTCTAGTGGGTAGGAGATCGCTT
>probe:Drosophila_2:1623988_at:581:277; Interrogation_Position=1192; Antisense; CTAGTGGGTAGGAGATCGCTTGTTA
>probe:Drosophila_2:1623988_at:682:679; Interrogation_Position=1200; Antisense; TAGGAGATCGCTTGTTATGGGCTTC
>probe:Drosophila_2:1623988_at:466:427; Interrogation_Position=1203; Antisense; GAGATCGCTTGTTATGGGCTTCCAG
>probe:Drosophila_2:1623988_at:713:97; Interrogation_Position=1204; Antisense; AGATCGCTTGTTATGGGCTTCCAGA
>probe:Drosophila_2:1623988_at:133:451; Interrogation_Position=1205; Antisense; GATCGCTTGTTATGGGCTTCCAGAA
>probe:Drosophila_2:1623988_at:287:45; Interrogation_Position=1206; Antisense; ATCGCTTGTTATGGGCTTCCAGAAT
>probe:Drosophila_2:1623988_at:326:273; Interrogation_Position=1210; Antisense; CTTGTTATGGGCTTCCAGAATCTAA
>probe:Drosophila_2:1623988_at:72:477; Interrogation_Position=1213; Antisense; GTTATGGGCTTCCAGAATCTAAGCT
>probe:Drosophila_2:1623988_at:228:65; Interrogation_Position=1216; Antisense; ATGGGCTTCCAGAATCTAAGCTGGA
>probe:Drosophila_2:1623988_at:515:307; Interrogation_Position=1224; Antisense; CCAGAATCTAAGCTGGAATTGGTCT
>probe:Drosophila_2:1623988_at:94:365; Interrogation_Position=1297; Antisense; GAATCACATACTGACCTGTACTTTG
>probe:Drosophila_2:1623988_at:423:239; Interrogation_Position=1298; Antisense; AATCACATACTGACCTGTACTTTGT
>probe:Drosophila_2:1623988_at:133:255; Interrogation_Position=1301; Antisense; CACATACTGACCTGTACTTTGTGAA

Paste this into a BLAST search page for me
CGCTCTAGTGGGTAGGAGATCGCTTCTAGTGGGTAGGAGATCGCTTGTTATAGGAGATCGCTTGTTATGGGCTTCGAGATCGCTTGTTATGGGCTTCCAGAGATCGCTTGTTATGGGCTTCCAGAGATCGCTTGTTATGGGCTTCCAGAAATCGCTTGTTATGGGCTTCCAGAATCTTGTTATGGGCTTCCAGAATCTAAGTTATGGGCTTCCAGAATCTAAGCTATGGGCTTCCAGAATCTAAGCTGGACCAGAATCTAAGCTGGAATTGGTCTGAATCACATACTGACCTGTACTTTGAATCACATACTGACCTGTACTTTGTCACATACTGACCTGTACTTTGTGAA

Full Affymetrix probeset data:

Annotations for 1623988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720