Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623989_at:

>probe:Drosophila_2:1623989_at:700:229; Interrogation_Position=1619; Antisense; AATGCTTGCCGTGAGTTGCCAAAAA
>probe:Drosophila_2:1623989_at:250:513; Interrogation_Position=1629; Antisense; GTGAGTTGCCAAAAATCGAGTCCTT
>probe:Drosophila_2:1623989_at:14:183; Interrogation_Position=1689; Antisense; AAAACCATTGCGTCTGCGGATGCAG
>probe:Drosophila_2:1623989_at:434:553; Interrogation_Position=1713; Antisense; GGAGCAGCTTAACTCATTCGACTAA
>probe:Drosophila_2:1623989_at:503:403; Interrogation_Position=1776; Antisense; GACTTTAATCTATCTGCTACTTGCA
>probe:Drosophila_2:1623989_at:570:359; Interrogation_Position=1798; Antisense; GCAAGTGTTACGAAGCCCGAACTAA
>probe:Drosophila_2:1623989_at:675:311; Interrogation_Position=1888; Antisense; GCTCAAGATGAATGGCACGTTTTAC
>probe:Drosophila_2:1623989_at:702:353; Interrogation_Position=1902; Antisense; GCACGTTTTACCATCATTATATCTA
>probe:Drosophila_2:1623989_at:726:545; Interrogation_Position=1964; Antisense; GGATGCTCGACGGATACTTTTATCT
>probe:Drosophila_2:1623989_at:204:681; Interrogation_Position=2015; Antisense; TATGTACGTGGAACTTTCTTTACTT
>probe:Drosophila_2:1623989_at:245:681; Interrogation_Position=2094; Antisense; TATGGCATCCGGAACGAGTCCAACC
>probe:Drosophila_2:1623989_at:28:87; Interrogation_Position=2110; Antisense; AGTCCAACCGGATATTTCAAGCAAA
>probe:Drosophila_2:1623989_at:400:615; Interrogation_Position=2163; Antisense; TGAATGTACATTCCCTTATCTGTTG
>probe:Drosophila_2:1623989_at:347:703; Interrogation_Position=2178; Antisense; TTATCTGTTGACTCACTTCCAAATA

Paste this into a BLAST search page for me
AATGCTTGCCGTGAGTTGCCAAAAAGTGAGTTGCCAAAAATCGAGTCCTTAAAACCATTGCGTCTGCGGATGCAGGGAGCAGCTTAACTCATTCGACTAAGACTTTAATCTATCTGCTACTTGCAGCAAGTGTTACGAAGCCCGAACTAAGCTCAAGATGAATGGCACGTTTTACGCACGTTTTACCATCATTATATCTAGGATGCTCGACGGATACTTTTATCTTATGTACGTGGAACTTTCTTTACTTTATGGCATCCGGAACGAGTCCAACCAGTCCAACCGGATATTTCAAGCAAATGAATGTACATTCCCTTATCTGTTGTTATCTGTTGACTCACTTCCAAATA

Full Affymetrix probeset data:

Annotations for 1623989_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime