Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623992_at:

>probe:Drosophila_2:1623992_at:652:151; Interrogation_Position=1690; Antisense; ACAGGCTAATGTAATGGCTCCACAA
>probe:Drosophila_2:1623992_at:483:419; Interrogation_Position=1719; Antisense; GAGCAGGTGTTGTTGAGACTCACAA
>probe:Drosophila_2:1623992_at:543:609; Interrogation_Position=1746; Antisense; TGAGCGATACCAGCGACGATGACGT
>probe:Drosophila_2:1623992_at:614:177; Interrogation_Position=1784; Antisense; AAACTGTCGGCTATTGGTGGCACTC
>probe:Drosophila_2:1623992_at:237:157; Interrogation_Position=1879; Antisense; ACACGTTGTCGAACTCCAGATGAGC
>probe:Drosophila_2:1623992_at:579:87; Interrogation_Position=1938; Antisense; AGTCCGGCAGACTTTCTAGGTCCAG
>probe:Drosophila_2:1623992_at:667:75; Interrogation_Position=1967; Antisense; AGGTCCATGTCCGACACCAAGTTGA
>probe:Drosophila_2:1623992_at:473:725; Interrogation_Position=1988; Antisense; TTGAGACCCAGGTCAAACTCCAGCG
>probe:Drosophila_2:1623992_at:158:125; Interrogation_Position=2009; Antisense; AGCGCCAGCTCTAGATCTAACTCTA
>probe:Drosophila_2:1623992_at:422:661; Interrogation_Position=2026; Antisense; TAACTCTAGTTCTAGCTCTGGCTCC
>probe:Drosophila_2:1623992_at:632:137; Interrogation_Position=2130; Antisense; ACGATTCCTCTGACGTTGAAGTGGT
>probe:Drosophila_2:1623992_at:187:615; Interrogation_Position=2146; Antisense; TGAAGTGGTCCCCAATGTACCCGAA
>probe:Drosophila_2:1623992_at:147:369; Interrogation_Position=2168; Antisense; GAAGGACAGCTGAGGGCCTAATCCT
>probe:Drosophila_2:1623992_at:279:531; Interrogation_Position=2245; Antisense; GGGTTTCACTACAAATATCCCAAAT

Paste this into a BLAST search page for me
ACAGGCTAATGTAATGGCTCCACAAGAGCAGGTGTTGTTGAGACTCACAATGAGCGATACCAGCGACGATGACGTAAACTGTCGGCTATTGGTGGCACTCACACGTTGTCGAACTCCAGATGAGCAGTCCGGCAGACTTTCTAGGTCCAGAGGTCCATGTCCGACACCAAGTTGATTGAGACCCAGGTCAAACTCCAGCGAGCGCCAGCTCTAGATCTAACTCTATAACTCTAGTTCTAGCTCTGGCTCCACGATTCCTCTGACGTTGAAGTGGTTGAAGTGGTCCCCAATGTACCCGAAGAAGGACAGCTGAGGGCCTAATCCTGGGTTTCACTACAAATATCCCAAAT

Full Affymetrix probeset data:

Annotations for 1623992_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime