FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623993_at:

>probe:Drosophila_2:1623993_at:77:445; Interrogation_Position=1023; Antisense; GATGAGGAGATAGCCGCCACTGCGC
>probe:Drosophila_2:1623993_at:110:37; Interrogation_Position=1071; Antisense; ATCAGGAAGGGAAACAGCCGCCAGC
>probe:Drosophila_2:1623993_at:660:311; Interrogation_Position=1090; Antisense; GCCAGCGCGCCGAGGATTAAGAAGT
>probe:Drosophila_2:1623993_at:620:373; Interrogation_Position=1110; Antisense; GAAGTACTCCATGTGCTTATGTGCA
>probe:Drosophila_2:1623993_at:396:509; Interrogation_Position=1130; Antisense; GTGCATATTTCACCTACTAGTTAGG
>probe:Drosophila_2:1623993_at:718:683; Interrogation_Position=1263; Antisense; TATCTTTAGTCGACTTGCATTCAAT
>probe:Drosophila_2:1623993_at:549:395; Interrogation_Position=713; Antisense; GAAATTCCGCGCCAATGTCGACGAG
>probe:Drosophila_2:1623993_at:394:99; Interrogation_Position=763; Antisense; AGATGAAAGCCTTCCGCAGGACGGA
>probe:Drosophila_2:1623993_at:540:631; Interrogation_Position=775; Antisense; TCCGCAGGACGGACAATCCCAAGGA
>probe:Drosophila_2:1623993_at:167:609; Interrogation_Position=899; Antisense; TGAGCAGCCCATCGACTGGCAGCTA
>probe:Drosophila_2:1623993_at:454:405; Interrogation_Position=912; Antisense; GACTGGCAGCTACCCAAAACGGATT
>probe:Drosophila_2:1623993_at:46:177; Interrogation_Position=928; Antisense; AAACGGATTACTACAGTGCTGCGCC
>probe:Drosophila_2:1623993_at:276:479; Interrogation_Position=957; Antisense; GTTTCCGCCTCGAGTGAACCAGAAC
>probe:Drosophila_2:1623993_at:44:379; Interrogation_Position=972; Antisense; GAACCAGAACCTCCAGTCAAGAAGT

Paste this into a BLAST search page for me
GATGAGGAGATAGCCGCCACTGCGCATCAGGAAGGGAAACAGCCGCCAGCGCCAGCGCGCCGAGGATTAAGAAGTGAAGTACTCCATGTGCTTATGTGCAGTGCATATTTCACCTACTAGTTAGGTATCTTTAGTCGACTTGCATTCAATGAAATTCCGCGCCAATGTCGACGAGAGATGAAAGCCTTCCGCAGGACGGATCCGCAGGACGGACAATCCCAAGGATGAGCAGCCCATCGACTGGCAGCTAGACTGGCAGCTACCCAAAACGGATTAAACGGATTACTACAGTGCTGCGCCGTTTCCGCCTCGAGTGAACCAGAACGAACCAGAACCTCCAGTCAAGAAGT

Full Affymetrix probeset data:

Annotations for 1623993_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720