Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623994_at:

>probe:Drosophila_2:1623994_at:705:437; Interrogation_Position=1245; Antisense; GAGGAAGATCCATCACTTGTCAAGA
>probe:Drosophila_2:1623994_at:118:401; Interrogation_Position=1295; Antisense; GACAGATCTCGATGTATATGACCAG
>probe:Drosophila_2:1623994_at:100:223; Interrogation_Position=1348; Antisense; AAGGGCATTCCGAATCTGACATCGT
>probe:Drosophila_2:1623994_at:718:611; Interrogation_Position=1364; Antisense; TGACATCGTGAGTACCGTGCAGGTA
>probe:Drosophila_2:1623994_at:545:671; Interrogation_Position=1376; Antisense; TACCGTGCAGGTAAAGGTCACCAAT
>probe:Drosophila_2:1623994_at:112:413; Interrogation_Position=1431; Antisense; GACCGGGAGCCCAAGAAAACAGCGA
>probe:Drosophila_2:1623994_at:505:121; Interrogation_Position=1451; Antisense; AGCGATCTTCGAGAGCAGCGTGTCC
>probe:Drosophila_2:1623994_at:493:353; Interrogation_Position=1465; Antisense; GCAGCGTGTCCCAGGTGCTAATAAA
>probe:Drosophila_2:1623994_at:629:373; Interrogation_Position=1545; Antisense; GAAGTCAAGCTAGGCTATCCACCAA
>probe:Drosophila_2:1623994_at:562:199; Interrogation_Position=1569; Antisense; AACGACTTGGTCTGCAGATACGCCA
>probe:Drosophila_2:1623994_at:26:235; Interrogation_Position=1593; Antisense; AATCCTCCGCGATGCAGACCTAAAT
>probe:Drosophila_2:1623994_at:567:119; Interrogation_Position=1623; Antisense; AGCTGCAGATGTCCTTGTCCGCCGT
>probe:Drosophila_2:1623994_at:505:227; Interrogation_Position=1693; Antisense; AATGCGATCCCATCTACGGTTTCGG
>probe:Drosophila_2:1623994_at:194:289; Interrogation_Position=1715; Antisense; CGGCGGCAAGTGTGTCGGATATTAT

Paste this into a BLAST search page for me
GAGGAAGATCCATCACTTGTCAAGAGACAGATCTCGATGTATATGACCAGAAGGGCATTCCGAATCTGACATCGTTGACATCGTGAGTACCGTGCAGGTATACCGTGCAGGTAAAGGTCACCAATGACCGGGAGCCCAAGAAAACAGCGAAGCGATCTTCGAGAGCAGCGTGTCCGCAGCGTGTCCCAGGTGCTAATAAAGAAGTCAAGCTAGGCTATCCACCAAAACGACTTGGTCTGCAGATACGCCAAATCCTCCGCGATGCAGACCTAAATAGCTGCAGATGTCCTTGTCCGCCGTAATGCGATCCCATCTACGGTTTCGGCGGCGGCAAGTGTGTCGGATATTAT

Full Affymetrix probeset data:

Annotations for 1623994_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime