Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623995_at:

>probe:Drosophila_2:1623995_at:314:369; Interrogation_Position=131; Antisense; GAAGGCTCCCAAGGCCGTCAAGGCG
>probe:Drosophila_2:1623995_at:204:313; Interrogation_Position=177; Antisense; GCCTCAGAGGCTAAAGTTTCCGCCA
>probe:Drosophila_2:1623995_at:303:295; Interrogation_Position=199; Antisense; CCAAGAAGTACAAGCGTCACGGACG
>probe:Drosophila_2:1623995_at:709:711; Interrogation_Position=243; Antisense; TTCACCGGCTACAAGCGTGGTCTGA
>probe:Drosophila_2:1623995_at:79:563; Interrogation_Position=268; Antisense; GGAACCAGCACGAGAACCAGGCCAT
>probe:Drosophila_2:1623995_at:131:381; Interrogation_Position=281; Antisense; GAACCAGGCCATCCTCAAGATTGAG
>probe:Drosophila_2:1623995_at:189:111; Interrogation_Position=322; Antisense; AGCACGGATCCTTCTACGTTGGGAA
>probe:Drosophila_2:1623995_at:534:275; Interrogation_Position=335; Antisense; CTACGTTGGGAAGCGTTGCGTCTAT
>probe:Drosophila_2:1623995_at:720:467; Interrogation_Position=349; Antisense; GTTGCGTCTATGTCTACAAGGCCGA
>probe:Drosophila_2:1623995_at:608:293; Interrogation_Position=371; Antisense; CGAGACCAAGAAGTGCGTGCCGCAG
>probe:Drosophila_2:1623995_at:561:595; Interrogation_Position=467; Antisense; TGTGCGTGCCCGTTTCAACAGGAAC
>probe:Drosophila_2:1623995_at:623:345; Interrogation_Position=523; Antisense; GCATCATGCTGTACCCATCAAGGAT
>probe:Drosophila_2:1623995_at:650:629; Interrogation_Position=559; Antisense; TCCGACTTGAATTACTGACCTGCAG
>probe:Drosophila_2:1623995_at:626:357; Interrogation_Position=636; Antisense; GCAACTTGGCTTTTTTATTAAGGCG

Paste this into a BLAST search page for me
GAAGGCTCCCAAGGCCGTCAAGGCGGCCTCAGAGGCTAAAGTTTCCGCCACCAAGAAGTACAAGCGTCACGGACGTTCACCGGCTACAAGCGTGGTCTGAGGAACCAGCACGAGAACCAGGCCATGAACCAGGCCATCCTCAAGATTGAGAGCACGGATCCTTCTACGTTGGGAACTACGTTGGGAAGCGTTGCGTCTATGTTGCGTCTATGTCTACAAGGCCGACGAGACCAAGAAGTGCGTGCCGCAGTGTGCGTGCCCGTTTCAACAGGAACGCATCATGCTGTACCCATCAAGGATTCCGACTTGAATTACTGACCTGCAGGCAACTTGGCTTTTTTATTAAGGCG

Full Affymetrix probeset data:

Annotations for 1623995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime