Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623996_at:

>probe:Drosophila_2:1623996_at:469:467; Interrogation_Position=1252; Antisense; GTTGTCTTCCAAGTTCCTACCATGT
>probe:Drosophila_2:1623996_at:431:61; Interrogation_Position=1273; Antisense; ATGTCCGGCGACAAGTTGCGCATCA
>probe:Drosophila_2:1623996_at:82:77; Interrogation_Position=1307; Antisense; AGGAGATCATCAAGCCGAACACGGT
>probe:Drosophila_2:1623996_at:652:347; Interrogation_Position=1337; Antisense; GCATCCAGGGATACGGGCTGCCATT
>probe:Drosophila_2:1623996_at:557:9; Interrogation_Position=1359; Antisense; ATTCCCCAAGGATACGACGCGCAAG
>probe:Drosophila_2:1623996_at:317:305; Interrogation_Position=1400; Antisense; CCTTCGACATTCAGTTCCCGGAGAA
>probe:Drosophila_2:1623996_at:183:295; Interrogation_Position=1513; Antisense; CGCAGTCCTTCGGTGAATCCAGGGA
>probe:Drosophila_2:1623996_at:351:201; Interrogation_Position=1569; Antisense; AACCGATCCCATTCATTTTGTAACA
>probe:Drosophila_2:1623996_at:725:491; Interrogation_Position=1588; Antisense; GTAACAACCCATCGAGATCTTGCTC
>probe:Drosophila_2:1623996_at:396:97; Interrogation_Position=1602; Antisense; AGATCTTGCTCCCATTTTGCTTGTT
>probe:Drosophila_2:1623996_at:180:313; Interrogation_Position=1648; Antisense; GCGCATTTTTTACAGGAACTCCCTC
>probe:Drosophila_2:1623996_at:649:381; Interrogation_Position=1663; Antisense; GAACTCCCTCTTAACAATCGGTTGT
>probe:Drosophila_2:1623996_at:729:185; Interrogation_Position=1675; Antisense; AACAATCGGTTGTGCTCATCTGCGC
>probe:Drosophila_2:1623996_at:184:283; Interrogation_Position=1694; Antisense; CTGCGCCGCGAACATGTTGCATAAT

Paste this into a BLAST search page for me
GTTGTCTTCCAAGTTCCTACCATGTATGTCCGGCGACAAGTTGCGCATCAAGGAGATCATCAAGCCGAACACGGTGCATCCAGGGATACGGGCTGCCATTATTCCCCAAGGATACGACGCGCAAGCCTTCGACATTCAGTTCCCGGAGAACGCAGTCCTTCGGTGAATCCAGGGAAACCGATCCCATTCATTTTGTAACAGTAACAACCCATCGAGATCTTGCTCAGATCTTGCTCCCATTTTGCTTGTTGCGCATTTTTTACAGGAACTCCCTCGAACTCCCTCTTAACAATCGGTTGTAACAATCGGTTGTGCTCATCTGCGCCTGCGCCGCGAACATGTTGCATAAT

Full Affymetrix probeset data:

Annotations for 1623996_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime